0
Total coating thickness, after drying of paints.
Wiki User
∙ 10y ago
Add your answer:
Earn +20 pts
What does the aumred mean?
Do you mean ''What does the AUM Mantra mean?''
Does mean mean average?
No, but sometimes "average" means "mean" - when it doesn't mean median, geometric mean, or something else entirely.
Did he had the concept of venn diagram?
The answer will depend on who you mean by HE.The answer will depend on who you mean by HE.The answer will depend on who you mean by HE.The answer will depend on who you mean by HE.
What does the word mean mean?
See mean-8. Or get a dictionary.
What is the deviation mean mean?
There is no statistical term such as "deviation mean".
How long is a scion tct 2005 trunk width?
A scion tct 2005 trunk is 5ft 9.1in in width.
What is the sequence of complementary nucleotides?
Ggc tct aac
What is the complementary nucleotide sequence of ccgagattg?
Ggc tct aac
What is TCT test in gynecology?
Thin-Prep Cytology Test
What is whole blood clotting time?
TCT is 5-8 minutes.
Is Vickie Winans related to Kathy Williams of the TCT network family?
Yes, they are biological sisters.
What was the day the blues brothers die?
Hi, Jake and Elwood didn't die. They went to "jail" but it seemed to me that it was jail that set them free. Love/Faith/Peace tct
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
Top ten engineering collage in mp?
1. Manit bhopal2. oriental_bhopal">oriental bhopal3. lnct bhopal4. tit bhopal5. sirt bhopal6. tct bhopal7. Truba Bhopal8. Bansal Bhopal9. GyanGanga Bhopal10. VNS Bhopal
Which strand of mrna would be made during transcription using the dna strand gat ccc?
Gcu aga
If you are drilling a hole in a wall with an electric hand drill then what action will make the hole be drilled faster?
more force drilling machine a drill with the 'hammer' facility and a good condition TCT drill bit. But, you do not necessarily need speed, you need acuracy
What are the steps involved in transcription and translation of a gene?
Aca tag gct aat gct aat cgt gca cga tct gaa cgatgt atc cga tta cga tta gca cgt gct aga ctt gct
