0
9
What else can I help you with?
Related Questions
What is the least common multiple of 312 and 8?
The least common multiple of 312 , 8 = 312
What is the Least Common multiple of 11 312?
The least common multiple of the numbers 11 and 312 is 3,432.
What is the least common multiple of 195 and 312?
Least common multiple of 195 and 312 is 1560.
What is the least common multiple of 312 and 182?
The least common multiple of the numbers 312 and 182 is 2,184.
What is the least common multiple of 13 and 24?
The LCM is: 312
What is the least common multiple of 136 and 144 and 312?
The least common multiple of 136, 144 and 312 is 31824.
What is the least common multiple of 8 12 and 52?
The LCM is: 312
What is the least common denominator of 28 and 312?
The LCD of 28 and 312 is 2184
What is the LCM of 104 and 78?
The Least Common Multiple of 78 and 104 is 312.
What is Least common multiple of 24 and 13?
312
What is the least common multiple 52 and 24?
312
What is the least common multiple of 312 and 16?
624
Trending Questions
Ano ang klaseng pagkain ang bawal na pagkain sa pusa?
How common are Ehlers Danlos syndromes?
What was the name of the first motor car?
Are there bugs on my skin?
What does devoted to a religion mean?
What is writing a fraction as an equivalent fraction with a larger denominator called?
What is 70 percent of 630?
Are Mario and Chris rock brothers?
Why are there no nerve endings in articular cartilage?
What age is Jo brand?
How much does a 2004 ferrari enzo cost?
How can you mine in Minecraft Pocket Editon?
Are you mad or nah?
Why did john Adams asserted that Jefferson plagiarized the declaration of independence from the works of which philosopher?
When does dratini evolve into a dragonair in Pokemon leaf green?
What is a quarter to seven?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What is the Royal Danish Ballet's Website?
What is the length of a triangle that has a 40 inch hypotnuse and a 90 degree angle?
What is the correct spelling of the singular possessive form of falcons?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.