0
16 tablespoons in a cup
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
What temperature is 12 degrees c colder that -4 degrees c?
16
What is 16 degrees C in degrees F?
16°C = 60.8°F
how do you convert F to C?
The temperature T in degrees Celsius (°C) is equal to the temperature T in degrees Fahrenheit (°F) minus 32, times 5/9: T(°C) = (T(°F) - 32) × 5/9 Convert 68 degrees Fahrenheit to degrees Celsius: T(°C) = (68°F - 32) × 5/9 = 20 °C
How many degrees below freezing is minus 16 c?
16° Freezing is normally the freezing point of water which is 0°C. Thus -16° is 16° below zero.
Which is bigger 1 gal or 15 c?
1 gal = 16 cOur staff says that 16 c is bigger than 15 c.
What does 16 T in a C mean?
16 T in a c means 16 Tablespoons in a Cup
What are the ratings and certificates for Lily C-A-T- - 1987 V?
Lily C-A-T- - 1987 V is rated/received certificates of: West Germany:16
What are the release dates for W-I-T-C-H- - 2004 Ghosts of Elyon 1-16?
W-I-T-C-H- - 2004 Ghosts of Elyon 1-16 was released on: USA: 20 May 2005
How many cups is in 72 ounces?
There is 16 T per cup therefore 72 T equals 4 1/2 c.
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
The amount of a persons paycheck p varies directly with the number of hours worked t For 16 hours of work the paycheck is 10800 Write an equation for the relationship between hours of work p equa?
p=t*C, where C is a constant value (in this case, the person's rate of pay). To determine C, solve for C for the p and t given. 10800=16C C=10800/16 C=800 Therefore, the equation is: p=800t
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
16 equals T in a C?
16 tablespoons in a Cup 1 cup = 8 ounces 2 tablespoons = 1 ounce so 16 tablespoons in a Cup
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
How many sandwiches can you make out of ham turkey roastbeef American cheese Swiss cheese and cheddar cheese?
24 different ways. wow that took a while turkey- TU cheese- C lettuce- L tomato- T Tu, C, L, T Tu, C, T L Tu, L,C,T Tu,L,T,C Tu,C,T,L Tu,C,L,T C,TU,L,T C,TU,T,L C,L,TU,T C,L,T,TU C,T,L,TU C,T,TU,L L,TU,T,C L,TU,C,T L,C,TU,T L,C,T,TU L,T,TU,C L,T,C,TU T,TU,C,L T,TU,L,C T,L,TU,C T,L,C,TU T,C,TU,L T,C,L,TU
