answersLogoWhite

0

Did Bernhard Riemann have a mother?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

Every person who ever lived had a mother.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

What did bernhard riemann do?

what did Bernhard Riemann do to be famous


Is Bernhard Riemann Catholic?

The mathematician Bernhard Riemann was not a Catholic, he was a Lutheran.


When was Bernhard Riemann born?

Bernhard Riemann was born on September 17, 1826.


What is Bernhard Riemann's birthday?

Bernhard Riemann was born on September 17, 1826.


When did Bernhard Riemann die?

Bernhard Riemann died on July 20, 1866 at the age of 39.


What was Bernhard Riemann invention?

George Bernhard Riemann's invention was The Riemann Hypothosis. (s=a+bi)=0) The Riemann Hypothosis states that s=a and a= 1/2 He died having his philosophy unfinished.


How old is Bernhard Riemann?

Bernhard Riemann was born on September 17, 1826 and died on July 20, 1866. Bernhard Riemann would have been 39 years old at the time of death or 188 years old today.


Who contributed to elliptic geometry?

bernhard riemann


What was Bernhard Riemann's inspirational inventions?

Riemann zeta function, Riemann hypothesis, Theory of higher dimensions, Riemannian metric


Did Bernhard Riemann have siblings?

Yes, Bernhard had five siblings, him being the second oldest.


What was Bernhard Riemann character traits?

kinda gay


Bernhard Riemann best known for?

his math skills

Trending Questions
What are the contribution of dr.gregorio velasquez? Why is valparin chrono 300 pescribed for? What are the questions the Dragon Den Elders ask you and what are the right answers? In football who first said hike when snapping the football? Is Minecraft Dangerous to buy? How does emilia's character change during the course of the play? What is gender stability? What is the speed limit when children are present in a school zone? What did William Dampier call Australia? What is the roman word for dinner? Why was Marc garneau's mission important? What is a carillon? How do I reset the filter light on my Samsung device? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What actors and actresses appeared in Brighton Beach Memoirs - 1986? Is The San Andreas fault in California is an example of a reverse thrust fault? What is the best therapeutic response to the patient with a lifethreatening disease? What scenario most clearly symbolizes guilt? What are examples of indirect characterization from Of Mice and Men? What type of circuit is most common in household wiring?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.