0
What else can I help you with?
Related Questions
How many angles does a rectangle have what are the four angels?
A rectangle has four (4) angles and they are all right (90 degrees)
A shape with four right angels?
Not having studied theology, I am not so sure about angels! A rectangle has four right angles. Also, any polygon with 5 or more sides can have four right angles.
What does a square and rectangle have in commo n?
Four straight sides, four right angels, diagonals that bisect one another.
What shape has four right angels and 2 paors of equal sides?
Any rectangle. (That includes squares.)
A rectangle with four equal sides and four equal angels?
Square
Does a rectangle have 2 acute angels?
a rectangle has 4 right angles
Do all rectangle have right angels?
Yes.
Does a rectangel have no right angels?
A rectangle has 4 right angles
Exactly how many right angels and vertices does a rectangle have?
A rectangle has 4 vertices and 4 right angles.
Does a rectangle have four right angles?
Yes, a rectangle has four right angles.
What has four right angles but is not a square?
A rectangle has four right angles but is not a square.
What is a quadrilateral with four right angles-?
A rectangle is a quadrilateral with four right angles True (Apex)
Trending Questions
How can you use inverse operations to solve an equation without algebra titles?
What does a compressional force cause?
What is the economic importance of zygomycota?
Why do women make succesfull leaders?
What are the S.I unit of electrical power?
Why is it important to synthesize a political speech?
How do you get are tithing back from church?
What is the least common multiple of 5 21 43 and 46?
How much water do you give to a radish?
Will there be a halo4?
What are the advantages of saltless water softeners?
What major problems with the utilitarian reliance on measurements include?
What causes global winds to appear to turn instead of blow straight across the earth's surface?
How long can you store nuts in freezer?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Was shadrach meshech and abednedo eunuchs?
How can the Olympus 100-400mm lens be effectively used to capture stunning images?
What is standing in the middle of piccadilly?
Calculate the simple interest on a loan with a principal of 6000 an interest rate of 7.39 percent and a term of four years?
Who will play as jessica drew in the live action Spider-Woman movie?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.