answersLogoWhite

0

FOR WHICH STANDERD IS THIS?

User Avatar

Chetviha S Narmatha ∙

Lvl 1
∙ 3y ago
Updated: 10/24/2021

THIS FOR 4TH GADE

User Avatar

Chetviha S Narmatha ∙

Lvl 1
∙ 3y ago
Copy

What else can I help you with?

Related Questions

What do you mean by indian accountency standerd and international accountency standerd?

business& Finanace and banking depend on them


Standerd or living is?

Living in the us


Is the standerd abbreviation for height h?

no it is ht.


how to 250 000 in standerd form?

10⁵x2.5


What is standerd form?

is when you spell a math problem written in words


How the heat resistant paint works?

What is the standerd backing teperature of H.R.Paint?


What does a area manager do?

check on the companys local shops are up to the companys standerd


What does 6 million look like?

Standerd:6,000,000Word And Number:6 million


What number in standerd form represents one thousand millions?

one billion


What is the mpg for a 2000 Saturn sl?

MY 2000 saturn is a standerd and I get an av of 38mpg


What is the weight capacity of a standard auto lift?

Your standerd lift is 1.000 lbs


How are the expanded algorithm and the standard algorithm are alike?

expanded is longer standerd is just regular partial products to find like standerd means simple your level. expanded means longer to stretch, or 2 make big.

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.