answersLogoWhite

0

HFC of 60 and 80

User Avatar

Shakira Butler ∙

Lvl 2
∙ 5y ago
Updated: 3/23/2020

20

User Avatar

Shakira Butler ∙

Lvl 2
∙ 5y ago
Copy

What else can I help you with?

Related Questions

What is 60 percent of 80 dollars?

80% of 60 dollars = 60*80/100 = 48 dollars


What Is 80 to 60 As A Fraction?

60 is 3/4 of 80.


What is 80 percent of 48?

48% of 80 = 48% * 80 = 0.48 * 80 = 38.4


What does 60 - 80 mean?

-20


What is 60 percent of eighty?

60% of 80= 60% * 80= 0.6 * 80= 48


80 percent of a number is 60 what is the number?

60 is 80% of what number:= 60 / 80= 60 / 0.8= 75


What is 80 add 60?

80 add 60 = 140


What is 80 plus 90 plus 60 plus 80?

The result of the equation - 80 plus 90 plus 60 plus 80, is found as follows; 80 + 90 + 60 + 80 = ( 80 + 90 ) + 60 + 80 = 170 + ( 60 + 80 ) = 170 + 140 = 310 Answer = 310


What is 130 plus 80 plus 60 plus 80?

The result of the equation - 130 plus 80 plus 60 plus 80, is found as follows;130 + 80 + 60 + 80= ( 130 + 80 ) + 60 + 80= 210 + ( 60 + 80 )= 210 + 140= 350Answer = 350


What is 60 plus 90 plus 60 plus 80?

The result of the equation - 60 plus 90 plus 60 plus 80, is found as follows; 60 + 90 + 60 + 80 = ( 60 + 90 ) + 60 + 80 = 150 + ( 60 + 80 ) = 150 + 140 = 290 Answer = 290


What is 130 plus 60 plus 60 plus 80?

The result of the equation - 130 plus 60 plus 60 plus 80, is found as follows;130 + 60 + 60 + 80= ( 130 + 60 ) + 60 + 80= 190 + ( 60 + 80 )= 190 + 140= 330Answer = 330


What percent of 80 is 60?

80 percent of 60 = 48

Trending Questions
How can you use inverse operations to solve an equation without algebra titles? What does a compressional force cause? What is the economic importance of zygomycota? Why do women make succesfull leaders? What are the S.I unit of electrical power? Why is it important to synthesize a political speech? How do you get are tithing back from church? What is the least common multiple of 5 21 43 and 46? How much water do you give to a radish? Will there be a halo4? What are the advantages of saltless water softeners? What major problems with the utilitarian reliance on measurements include? What causes global winds to appear to turn instead of blow straight across the earth's surface? How long can you store nuts in freezer? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? Was shadrach meshech and abednedo eunuchs? How can the Olympus 100-400mm lens be effectively used to capture stunning images? What is standing in the middle of piccadilly? Calculate the simple interest on a loan with a principal of 6000 an interest rate of 7.39 percent and a term of four years? Who will play as jessica drew in the live action Spider-Woman movie?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.