0
What else can I help you with?
Related Questions
How do you write19 over 8 as a mixed number?
2 3/8
How do you write 0.08 in decimal words?
There are no decimal words! The number is eight hundredths.
Decimal numbers in words 12.9?
write the following decimal numbers in words .0087945
When writing a decimal number in words the decimal point is written as?
"and"
What is 3.620 in decimal words?
Not sure what decimal words are! The number is three and six hundred and twenty thousandths.
What is the decimal word form of 8.034?
Not sure about decimal words. But in normal words, the number is eight and thirty-four thousandths.
How do you write 4.5 into a decimal?
4.5 is already a decimal. In words it is four and five tenths.
How do you write 431.988 in decimal words?
431.988 in decimal words = four hundred thirty-one and nine hundred eighty-eight thousandths.
How do you write decimal .12 in words?
.12 in words is twelve hundredths.
What is the decimal 0.003 in words?
three thousandths.
What is the decimal 0.03 in words?
Three hundredths.
What is 0.367 in decimal words?
367 Thousandths
Trending Questions
Can a parent kick you out if you are over the age of 18?
What is the Gosselin family's political affiliation?
How tall is Radhaa Nilia?
What level does lombre learn fake out?
Which of the following is NOT one of the so-called pillars of primary health care as outlined by the Declaration of Alma Ata?
What are animal claws used for?
What is the distance between two longitudes at the equator?
Does ingrown toenail surgery hurt?
When was Black dress of Rita Hayworth created?
Who does Mr Pilkington represent in Animal Farm?
Is the moon made out of sand?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What if caffeine does not have an effect on you?
What is the definition of futile?
Why is there an Australian midget pooping in your attic?
How much does a cintas ssr make?
Michael's Coupons?
What does miogynistic mean?
What are three examples of governmental actions that might interfere with free market?
What are the 4 major civic duties?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.