answersLogoWhite

0

How do you write 81 as 2nd power?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/20/2019

92 = 81 AND 3^4

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

What are two ways to write the number 81?

9 to the 2nd power (92) 3 to the 4th power (34)


How do you write the number 81 as a power in math?

9 to the power of 2 = 81


9 to the 2nd power?

It is: 81


How do you write the number 81 as a power?

9 to the second power :))


How do you write 81 as a power?

I think it's 92


What is 9 to the 2nd power?

92=9x9=81 9 to the second power or 9 squared (92) equals 81.


What is 9 to the negative 2nd power?

Negative 9 to the negative 2nd power (-9-2) = 0.012345679 (repeating).


What is 9 to the power of -2?

81.


16r to the 2nd power plus 81-72r equals?

16r2+9r


Use exponents to write the number 81 three different ways?

3 to the power of 4 9 to the power of 2 81 to the power of 1 I'm on this problem in my notebook too ;)


How do you write 81 as a power in three different ways?

You can express 81 as a power in several ways: ( 81 = 3^4 ) because ( 3 \times 3 \times 3 \times 3 = 81 ). ( 81 = 9^2 ) since ( 9 \times 9 = 81 ) and ( 9 ) can be rewritten as ( 3^2 ). ( 81 = (3^2)^2 ) which simplifies to ( 3^{2 \times 2} = 3^4 ). Thus, all representations confirm that ( 81 ) can be expressed as a power in different forms.


What is 3 to the fourth power?

3 to the fourth power=81Three to the fourth power is 81.

Trending Questions
Why can't regular pentagons tesselate? What is the scientific name for sensitive skin? What are synonyms for forefront? When was Luke called by Jesus? What are some common communication challenges faced by individuals with hyperverbal autism? What is ASDA's equal opportunities policies? Which is farther south Brownsville in the US or the city of chihuahua? When did Abraham Lincoln went to see the Antietam battlefield? What do you call a frozen pickle? Pokemon Platinum game id code? Is Jamaica in Brazil? Does cooper die in One Tree Hill? What kind of damage did hurrricane earl do? What is a peripheral graphic array? How many Buddy Holly records have been sold? Who is lulia in to kill a mockingbird? Do 8 and 16 hour security guard training certificates in NYC lose merit after time or anything else? What has the author June Vendall Clark written? What weapons does the 82nd airborne division use? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.