0
What else can I help you with?
Related Questions
What is the metric unit of measurement similar to an inch in the English system?
The metric unit of measurement similar to an inch in the English system is the centimeter.
Is one centimeter equal to an inch?
No, one centimeter is not equal to an inch. One inch is equivalent to 2.54 centimeters.
Whats larger a centimeter or an inch?
An inch is larger than a centimeter. There are exactly 2.54 centimeters in one inch.
Which is larger an inch or a centimeter?
An inch is larger than a centimeter. One inch is equivalent to 2.54 centimeters.
Which is greater a inch or centimeter?
centimeter
Which is more a centimeter or an inch?
centimeter
Is one centimeter is longer than one inch?
No. An inch is longer then a centimeter. (:
Which is smaller the inch or the centimeter?
the centimeter is smaller
What is shorter an inch or a Centimeter?
a centimeter dummy
Is centimeter or inch smaller?
centimeter
What is the inch to centimeter ratio?
1 inch = 2.54 centimeters or .3937007874 of an inch = 1 centimeter
Which is larger the inch or the centimeter?
An inch is larger.
Trending Questions
How are a lion and mountain lion different?
What is the atomic mass of argon in grams?
How long has Utah been a state in the USA?
Who are all the Dr. Who characters?
Why Do People Go Red When They Are Angry?
How much does a public relations person make?
When the time was right?
What does Mae Jemison fear?
Can silica make your skin itchy?
What properties do only gases have?
Why arnt there any mountains in Africa?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Will the bells ring if there is black smoke for the pope election?
Why are cars important to 13-year-olds?
What is nationality of actress portraying Pocahontas in movie the new world?
How will joey get married?
Where can one find an equity loan second mortgage?
What is the Lifeproof IPhone Headphone Adapter cord used for?
What do you do to get in labor?
Are children responsible for medical bills of a deceased parent when there is an estate or will?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.