Tags Math and Arithmetic Units of Measure

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Natural Sciences

How many centimeaters are in an inch?

Updated: 10/23/2022

Wiki User

∙ 13y ago

Best Answer

1.0 in = 2.54 cm

Wiki User

∙ 13y ago

This answer is:

Add your answer:

Earn +20 pts

Q: How many centimeaters are in an inch?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Natural Sciences

Howw many centimeters in an inch?

1 inch= 2.54 centimeters

How many centemeaters is in a inch?

There are 2.54 centimeters in an inch.

How many inches equals 1 inch?

One inch equals one inch.

How many millimeter are in an inch?

25.4 mm = 1 inch

How many mimlimeters are in an inch?

25.4 mm per inch

Related questions

How many centimeaters are in 19 inches?

One inch equals 2.54 cm so 19 inches =19x2.54=48.26 cm

How many centimeaters in a meter?

1m is100 cm.

How many centimeaters is in a meter?

One thousand milliliter is one

How many millimeaters in 4.6 centimeaters?

4.6 centimetres = 46 millimetres

How many centimeaters equal 25 meaters?

1 m is 100 cm, so 25 m is 2500cm.

What is 150 centimeaters in ft?

4.921 259 842 5 feet

What is the measure of the side length of a square that has an area of 49 square centimeaters?

12.25

What is the area of a rectangle that measures 4 centimeaters by 9 centimeters?

It is: 4*9 = 36 square cm

How many inch in1cft?

how many inch in 1cft

How many quarts of an inch in half inch?

Two quarters of an inch are in a half inch.

Howw many centimeters in an inch?

1 inch= 2.54 centimeters

How many 32 are in 1 inch?

how many 32 are in 1 inch

Trending Questions

What things can be found in poopdeck? When was Jacques Cousteau National Estuarine Research Reserve created? Can a pure substance be dissolve? What time is 7 pm est equal to India time? Where did Volcanos Come From? Wind and ocean currents do not move in straight lines This is called? Did Lloyd Augustus Hall have any children? What is the rate for Isotopes? What is the mRNA strand for ggctatatcctgcgctatacgcta? How are volcanoes and tornadoes alike? How is the sycamore seed suited to its meshed of dispersal? What is a Imaginary line perpendiculer to the boundary between the media? What is the lower part of the mantle that extends down to the core called.? Who can be carrier of autosomal disorder? Where are specific motor and sensory functions localized? Does serratia test negative for citrate? What is the superlative for loud? What is the air quality index in most communities in the US? What is sublimationIs grinding of chalk a physical changewhat is its indicator of change? What are career clusters for a meteorologist?

Previously Viewed

How many centimeaters are in an inch?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.