0
What else can I help you with?
Related Questions
How many is 60 inches to feet?
60 inches = 5 feet
How how many feet are equal to 60 inches?
There are 5 feet in 60 inches
How Many Inches Make 5 feet?
5 feet= 60 inches
How many inches in 5 Feet?
There are 60 inches in 5 feet but no inch's.
How many square inches are in 5 square feet?
5 square feet is (5 feet) x (5 feet)5 feet = 60 inches.Replace 5 feet with 60 inches.60 inches x 60 inches = 3600 square inches
If your height is 60 meters how many feet and inches is that?
60 meters is 196 feet 10.2 inches.
How many feet is 725 inches?
60 (feet) X 12 (inches/feet) 720 (inches), and 725 - 720 5, so 725 inches is 60 feet and 5 inches.
How many inches is five feet tall?
5 feet = 60 inches. There are 12 inches per foot
How many inches in 60 foot diamater?
60 feet = 720 inches
How many feet are in 60 inches?
There are five feet in 60 inches, as there are 12 inches in one foot.
How many square feet is 60 inches by 60 inches?
12 inches = 1 foot Hence 60 inches -= 5 feet So 60 inches X 60 inches => 5ft X 5ft = 25 sq.ft.
How many feet is there in 60 inches?
Five feet.
Trending Questions
What is an example of paradoxes?
What part of an element determines its ability to combine with other elements?
How do you Manage copper levels in a hot tub?
Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person?
What kinds of credit cards allow one to apply online?
What should I do if my dog is tired and has a dry nose?
2 cups is equal to how many ml's?
50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution?
Who was Athena' rival in the city-state?
What is a recipe from colonial Rhode Island?
Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK?
What is P0153 codes on Toyota Sienna 3.0 engine?
Which concept did the Maya understand before europeans?
What is 12times 8?
Does Jon Gruden still get paid from the buccaneers?
How can I find a replacement head for my Kobalt weed eater?
Why is my kitten growling while playing?
How do you define global environmental scan.?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What happened to st therese of lisieux when she was 4?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.