0
What else can I help you with?
How many tons is 8 million g?
8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)
If one side of the DNA molecule is t-t-t-g-a-c-c-a-g how do you figure the other side?
To determine the complementary strand of DNA, you would match each base with its complementary base: T -> A, A -> T, G -> C, C -> G. So, the complementary strand to t-t-t-g-a-c-c-a-g would be a-a-a-c-t-g-g-t-c.
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.
How many gene pairs are in human DNA?
2 A-T one pair C-G other par
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A
What is the complementary strand for this sequence for c-g-t-g-a-g-a-c-c-t-g-g-c-a-c-t-a-a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
If one side of the DNA chain reads a t g c g t t a g a c c t then the other side will be?
The complementary DNA strand would read T A C G C A A T C T G G A. This is because in DNA, adenine pairs with thymine and guanine pairs with cytosine. So, by replacing each base with its complementary base, we can determine the other side of the DNA chain.
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
the complimentary styrand would be: T-C-C-G-A-T
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
The DNA replication for the given sequence "ttcgagacttagtcggatgtgaagtggtgatt" would involve the separation of the DNA double helix into two strands, with each strand serving as a template for the synthesis of a new complementary strand. This process is carried out by DNA polymerase enzymes, which add complementary nucleotides to the exposed bases on each template strand. As a result, two identical DNA molecules are produced, each containing one original strand and one newly synthesized strand.
Which represents a deletion of a section of DNA shown here a c t g g a t?
Deletions could be c-t-g-g-a-t or a-c-t-a-t or many other things missing a base or sequence of bases. However, in a simple deletion mutation the order of the nucleotides does not change.
