0
What else can I help you with?
How many tons is 8 million g?
8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)8000000.00 g = 8.81849 t(US)
If one side of the DNA molecule is t-t-t-g-a-c-c-a-g how do you figure the other side?
To determine the complementary strand of DNA, you would match each base with its complementary base: T -> A, A -> T, G -> C, C -> G. So, the complementary strand to t-t-t-g-a-c-c-a-g would be a-a-a-c-t-g-g-t-c.
What is the amino acid for t a c g c g c c t a g g g g g t g g?
A t g t g g a a c c g t g
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
B. G-G-A-T-G-C is the complement strand to C-C-A-T-C-G. The complementary base pairs are as follows: C-G, C-G, A-T, T-A, C-G, G-C.
How many letters does DNA have?
A,C,T,G "A" and "T" always pair "C", "G" always pair
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
What is the complementary strand for this sequence for c-g-t-g-a-g-a-c-c-t-g-g-c-a-c-t-a-a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
If one side of the DNA chain reads a t g c g t t a g a c c t then the other side will be?
The complementary DNA strand would read T A C G C A A T C T G G A. This is because in DNA, adenine pairs with thymine and guanine pairs with cytosine. So, by replacing each base with its complementary base, we can determine the other side of the DNA chain.
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
the complimentary styrand would be: T-C-C-G-A-T
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
The DNA sequence provided is: TTCGAGACTTAGTCGGATGTGAAGTGGTGTATT To replicate this DNA sequence, the double-stranded DNA unwinds, and new DNA strands are synthesized using the original strands as templates. Adenine pairs with thymine and cytosine pairs with guanine, following the base pairing rules. This results in two identical DNA molecules, each containing one original strand and one newly synthesized strand.
