0
What else can I help you with?
Related Questions
How many silver medals has Emily seebohm won?
eighteen
How many bronze medals has Emily seebohm won?
8
How many medals has Emily Seebohm won?
she has won 35medals in her life
How many silver medals has Emily Seebohm?
Emily Seebohm has won two Olympic Silver Medals (both at the London 2012 Olympic Games):100m backstroke (behind the American Missy Franklin) and in the 4x100m medley relay(behind the mighty US team).*As of August 5th, 2012.
How many hours from Nice to Marbella by train?
6 hours
How many hours is Manchester from London by bus and by train?
Around 4.5 hours by bus and around 2:15 hours by train.
How many hours from Zurich to Geneva by train?
About 3 hours.
How many hours by train from Edinburgh to Thornton?
Around 2 hours
How many hours does it take by train to get to Birmingham from Essex?
42 hours
How many hours a day did Cathy freeman train?
6.5 hours
How many hours by train is Amsterdam from Frankfurt?
Seven and a half hours.
How many hours in train from Bari Italy to Rome Italy?
An express train from Rome to Milan takes about three hours. A normal train may take between four and five hours.
Trending Questions
How can you use inverse operations to solve an equation without algebra titles?
What does a compressional force cause?
What is the economic importance of zygomycota?
Why do women make succesfull leaders?
What are the S.I unit of electrical power?
Why is it important to synthesize a political speech?
How do you get are tithing back from church?
What is the least common multiple of 5 21 43 and 46?
How much water do you give to a radish?
Will there be a halo4?
What are the advantages of saltless water softeners?
What major problems with the utilitarian reliance on measurements include?
What causes global winds to appear to turn instead of blow straight across the earth's surface?
How long can you store nuts in freezer?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Was shadrach meshech and abednedo eunuchs?
How can the Olympus 100-400mm lens be effectively used to capture stunning images?
What is standing in the middle of piccadilly?
Calculate the simple interest on a loan with a principal of 6000 an interest rate of 7.39 percent and a term of four years?
Who will play as jessica drew in the live action Spider-Woman movie?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.