0
What else can I help you with?
Related Questions
How much pints goes into 48ounces?
That is 3 US pints
How many pints equals 3 pints?
3 pints
How many pints are in 3 over 8 gallon?
3 pints
How many cups go into how many pints?
It goes like this. Pint =4 cups 2 Pints = 8 cups 3 Pints = 12 cups So every pint, your adding 4 cups.
3 pints equals to how many pints?
3...
How many pints are in 3 pounds or water?
3 pints
How much capacity is in 3 pints?
3 pints to many
How many pints are in 2 cups and 2 pints?
3 Pints
How many pints are in 3 gal?
3 Gallons = 24 Pints
How many pints are in six cups?
3 Pints
How many pints 3 quart?
6 pints
48 fluid ounces are in how many pints?
there are 3 pints in 48 fluid ounces
Trending Questions
WHAT CLOTHES SHOULD YOU BRING FOR JUPITER?
Is the lead singer in 3oh3 a Christian?
Do birds on a telephone line wire indicate the coming of rain?
Is the lead singer of Avenged Sevenfold Jewish?
Where can you play mugen match 9?
Who were the next door neighbors on the TV series Maude?
Did Ice Cream flavored chewing gum ever exist?
How many cats can you feed if you get three fourths of cat food and sixteen and one half of cat food?
What is the LCM of 5and6and8?
Who gives a persuasive speech at Caesar's funeral?
What is the greatest common factor of 14 35 and 63?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
When was Edward Lawry Norton born?
Whose court was birbal a minister in?
Calibration of compass 1996 Dodge Ram 1500?
Is mothball smell harmful to babies?
Can you exercise while having an IUD?
Is the white guy dead that played roach in next friday?
Who was attila the hun's mother?
Does nitrogen have a positive or negative charge?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.