Tags Math and Arithmetic

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

How many times does 150 go into 4?

Updated: 10/17/2024

Wiki User

∙ 9y ago

Best Answer

37 times with a remainder of 2

Wiki User

∙ 8y ago

This answer is:

More answers

Wiki User

∙ 8y ago

37.5 times.

This answer is:

Anonymous ∙

Lvl 1

∙ 4y ago

37

This answer is:

Anonymous ∙

Lvl 1

∙ 4y ago

Hhv

This answer is:

Add your answer:

Earn +20 pts

Q: How many times does 150 go into 4?

Write your answer...

Submit

Still have questions?

imp

Related questions

How many times does 150 go in 600?

4 times.

How many times does 35 go into 150?

150 ÷ 35 = 4 with remainder 10 or 4.2857 times.

How many times does 4 go into 600?

150.

How many times can 30 go into 150?

5

How many times can 37 go into 150?

4 times with a remainder of 2

How many times can 32 go into 150?

4 times with a remainder 22

How many times dose 4 go into 150?

37 times with a remainder of 2 or 37.5 times

How many times does 20 go into 80?

How many times dose 20 go into 150

How many times does 4 go into602?

It goes: 602/4 = 150 with a remainder of 2 or as 150.5

How many times does four go into 150?

37 with 2 remaining 150 - 2 = 148 = 4 x 37

How many times does 6 go into 160?

160 ÷ 6 = 26 with remainder 4

How many times can 4 go into 150?

37 with remainder 2.

Trending Questions

How many cups are in a 50 oz bag of hash browns? Why is homosexuality deemed to be deviant? What the adaptations of the thoracic vertebra? What is the price of condoms? Where did God ask Abraham to move from? What does it mean when two variables have a positive correlation? When was geometric art created? How do you reset the engine light on a ford f150xlt? What is the origin of the word 'porpoise'? Are you responsible for someones back taxes if they claim you as a dependent? When was the Tasmanian tiger's breeding season? The name of the quitarist who plays contigo en la distancia? Earthquakes are studied in the scientific discipline called .? Is the West Indies located between the Bahamas the greater antilles or the lesser antilles? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? What is a swarm in pokemon soulsilver? How many phonemes in the word snowman? How many withers do horses have? Why were the Jews considered undesirables? What do Russians like?

Previously Viewed

How many times does 150 go into 4?

Unanswered Questions

How to record lectures in a class? Is 8,048 a multiple of 8? What Role Does Innovation Play in Reviving the Jute Industry? How do I choose the best women's fragrance for everyday use? Why is Hbno(dot)com considered the best place to buy essential oils online? What type of tests are performed during a geotechnical investigation? What should I do if I need urgent medical care? How do I make an appointment with a doctor or specialist in Malaysia?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.