0
What else can I help you with?
Related Questions
How old would you be if you were born in May 1979?
33
How old is Ashley in WWE?
She is 30. She was born on May 26, 1979.
How old is Rosario Dawson?
Rosario Dawson was born on May 9, 1979
How old is Lindsey Ballato?
she was born on may 22nd, 1979. making her 30 years old.
How old is Clint Bowyer?
Clint Bowyer is 38 years old (birthdate: May 30, 1979).
How old is Lance Bass?
Lance Bass is 38 years old (birthdate: May 4, 1979).
How old are you if you were born in nov of 1979?
32 years (answered May 2012)
How old is WWE ashely?
Ashley Massaro is 30 years old She was born in may 26th 1979
How old is rhoda montemayor?
Rhoda Montemayor is 31 years old. She was born on May 31, 1979.
How old will you be if you were born in 1979?
If you were born in 1979, you will turn 31 in 2010.
If someone is born in 1979 how old will they be now?
They would be 33 if they were born in 1979
How old is Jon Wilkin?
Jonathan "Jonny" Wilkinson is 38 years old (birthdate: May 25, 1979).
Trending Questions
How bad does it hurt to put ice in your hand and add salt?
What sort of talks has holden had with carl in the past?
What colour eyes does Mr bean have?
What is the pluralistic view of svereignty.Discus its strength and weakness?
How many times will 36divide into 43264?
Does a 12 foot rowboat need to be registered under Michigan state law?
What element has common oxidation numbers that are plus 2 and plus 3?
Who is the actress in star plus anthem -tu hi tu?
What or who are the cicones?
Do medicine go bad after expiration date?
How many people were killed by Hurricane Katrina?
What can one buy from The Brick Canada online store?
How can you get involved to stop gun and knife crime?
Find the distance between the points: (-4, 15) and (1, 3)?
How do you pronounce knute rockne's name?
What is the keystroke to get windows to boot from the CD?
Polaris Ranger speeds?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
Is the North Pole near Antarctica or europe?
What benefits might pyloric caeca provide to fish?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.