answersLogoWhite

0

Is 117 composite

User Avatar

Anonymous

∙ 14y ago
Updated: 8/17/2019

Yes

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

What is the prime or composite of 117?

117 is composite.


What are the prime or composite of 117?

117 is composite.


Is 117 prime or composite?

117 is a composite number; its factors are 1, 3, 9, 13, 39, and 117.


Are 113 117 105 composite?

113 is prime. 117 and 105 are composite.


Is 117 a prine or composite?

composite


Is 117 is a composite number?

117 is a composite number having the factors 1, 3, 9, 13, 39, and 117.


Is 90 and 117 prime numbers?

90 is composite, 117 is prime.


Is 117 a greatest common divisor a prime number?

117 is composite.


Is 117 a composite number?

Yes.


Is 117 a prime or composite number?

No, it is not a prime number. 117 can be divided evenly. 117 divided by 9 is 13.


Are 107 and 117 prime numbers?

107 is a prime number but 117 is a composite number


Why is 117 not prime?

117 is a composite number and not a prime number because it is divisible by 1, 3, 9, 13, 39, 117

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.