0
What else can I help you with?
Related Questions
Are 25 and 40 multiples of 5?
325
What are first multiples of 5?
The first 10 multiples of 5 are: 5, 10, 15, 20, 25, 30, 35, 40, 45, and 50.
Multiples of 5 and 7?
5 10 15 20 25 30 35 40
What are multiples of 5 between 1-50?
The integral multiples are 5, 10, 15, 20, 25, 30, 35, 40, and 45.
What are the multiples of 5 and 40?
5, 10, 15, 20, 25, 30, 35, 40.
Is 16 or 25 or 40 or 64 or 90 or 120 a multiples of 5 and 8?
40 and 120, yes. The rest, no.
What is multiples of 5 between 25 and 50?
30, 35, 40, 45
What are the multiples of 5 and 6?
Multiples of 5 are 5, 10, 15, 20, 25, 30, 35, 40, and so on. Multiples of 6 are 6, 12, 18, 24, 30, 36, and so on.
What are the multiples of 5 less than 40?
5 10 15 20 25 30 35
What are the multiples of 5 that add up to 50?
55
What are the first twelve multiples of 5?
The first twelve multiples of 5 are: 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 and 60.
What the multiples of 5 that are less than46?
5, 10, 15, 20, 25, 30, 35, 40, 45
Trending Questions
How can you use inverse operations to solve an equation without algebra titles?
What does a compressional force cause?
What is the economic importance of zygomycota?
Why do women make succesfull leaders?
What are the S.I unit of electrical power?
Why is it important to synthesize a political speech?
How do you get are tithing back from church?
What is the least common multiple of 5 21 43 and 46?
How much water do you give to a radish?
Will there be a halo4?
What are the advantages of saltless water softeners?
What major problems with the utilitarian reliance on measurements include?
What causes global winds to appear to turn instead of blow straight across the earth's surface?
How long can you store nuts in freezer?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Was shadrach meshech and abednedo eunuchs?
How can the Olympus 100-400mm lens be effectively used to capture stunning images?
What is standing in the middle of piccadilly?
Calculate the simple interest on a loan with a principal of 6000 an interest rate of 7.39 percent and a term of four years?
Who will play as jessica drew in the live action Spider-Woman movie?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.