0
Is a trap primer line where it is connected to the waste line part of the DWV system or could it be a by code domestic cold water line?
Wiki User
∙ 13y ago
Trap primer is connected to domestic cold water line close to a fixture. Trap primer water line runs to a DWV trap made for trap primer usage.
Wiki User
∙ 13y ago
A trap primer line is typically connected to the domestic cold water line, not the DWV system. Its purpose is to prevent evaporation of water in floor drains or traps by periodically supplying small amounts of water. In some cases, local Plumbing codes may dictate specific requirements for trap primers.
Add your answer:
Earn +20 pts
Was the alliance system good or bad?
The alliance system had both positive and negative consequences. On the positive side, alliances could provide security and mutual defense for member nations. However, they also increased the likelihood of conflict by creating a complex web of obligations that could drag multiple countries into a war. Ultimately, the alliance system contributed to the escalation of World War I.
What causes error code P505?
Error code P0505 typically indicates a fault with the idle air control system. This could be due to a faulty idle air control valve, a vacuum leak, or a problem with the throttle body. It is recommended to have the system inspected by a mechanic to diagnose and repair the issue.
What are the differences between a use-case diagram and use case?
A use-case diagram is a visual representation of the interactions between actors and the system, showing how users interact with the system to achieve goals. A use case is a description of a specific interaction between a user and the system to accomplish a goal. Use cases are typically detailed in text format and provide more specific information compared to the use-case diagram.
Should schools provide day care for their students with children?
Schools could consider offering daycare services for students with children to help support their education. This could ensure that students can still attend classes and focus on their studies while knowing that their children are being cared for in a safe environment. Offering daycare could also contribute to increased accessibility and inclusivity for student parents.
Was the paddle wheel for energy?
The paddle wheel was used to convert the energy of moving water into mechanical energy, which could then be used to perform work, such as grinding grain or sawing wood. The flow of water would turn the paddles on the wheel, causing it to rotate and transfer the energy to a connected mechanism.
How do you remove PVC plumbing primer?
you cant remove primer. if its an eye sore for you . You can try to hide the purple primer by either panting the pipe or you could use clear primer next time. primer was made to clean the fittings and weaken the pipe so the glue would react to the PVC pipe. making one piece. thay make purple prime so city inspectors could visualy see that the plumber properly prepared the pipe.
Under the Chinese civil service system who could become government officials?
In the Chinese Civil Service system, technically anyone could become a government official though often it goes to politically connected individuals.
Do I need to use primer before I paint in my bedroom?
Yes or it could peal later.
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
Is yak a domestic or a wild animal?
Generally wild. They could be domestic, when reared as cattle for milk.
Could you define internet facing?
Internet facing means a system with a port, typically ehternet, directly connected to an internet modem or network interface unit.
What you can do about the Domestic Violence?
The things you could do about domestic violence is first. Avoid it, if your partner is violent discuss it, if no change, leave.
Why did the Factory System replace the domestic system of production in the Industrial Revolution?
The factory system replaced the domestic system because it was much more efficient and the machines got too big and too expensive to keep in the house, so people moved to factories. This together meant people could earn more money, more quickly which ultimately made it a much better system and made people richer.
What color polyurethane primer is good for a light color polyurethane paint?
Primer is almost always the exciting color of light gray, so if you're painting with a light color, you should stick with the gray. Primer could theoretically come in any color, but gray is what you'll nearly always see used. Sometimes a shop will use a darker primer such as red for certain darker colors of paint so that they won't have to use as many coats of paint to cover the usual gray primer.
What does the phrase 'mi primer dia sin ti' mean?
The Spanish phrase "mi primer dia sin ti" means my first day without you. This is a literal translation and could be interpreted in several different ways.
Where could one purchase Smashbox primer?
Smashbox primer is a type of cosmetics. That should be available in a number of stores including department stores, drug stores, warehouse stores, and online at retailers like eBay, and Amazon.
Who could become government officials Under the Chinese civil service?
In the Chinese Civil Service system, technically anyone could become a government official though often it goes to politically connected individuals.
