Is twelve a common factor

Anonymous

∙ 15y ago

Updated: 8/17/2019

yes, because it has more than one factor. the factors of 12 are: 1,12 2,6 3,4

Wiki User

∙ 15y ago

What else can I help you with?

What is the greatest common factor of twelve and thirtysix?

Since 12 is a factor or 36, it is automatically the GCF.

What is the greatest common factor of twelve and thirty six?

Twelve

What numbers have the greatest common factor of twelve?

1,2,4,7,9

What is the greatest common factor of ten and twelve?

What is the least common factor for three and twelve?

What is the greatest common factor of twelve and twenty?

The answer is 4.

What is the lowest common factor For five and eight and twelve?

The least common factor of any set of integers is 1.

What is the lowest common factor of nine ten twelve?

What is the greatest common factor of nine and twelve?

The GCF is 3.

What is the greatest common factor of twelve and eight?

The greatest common factor between twelve and eight is four. Don't get confused about greatest common factor and greatest common multiple. There is GCF and GCM, be sure to pay extra attention to the last letter or word, whichevere form it is in.

Is the greatest common factor of thirty and seventy-two twelve?

No, it's six. 12 is not a factor of thirty.

What is the greatest common factor of nine over twelve used as a fraction?

Three

Trending Questions

WHAT CLOTHES SHOULD YOU BRING FOR JUPITER? Is the lead singer in 3oh3 a Christian? Do birds on a telephone line wire indicate the coming of rain? Is the lead singer of Avenged Sevenfold Jewish? Where can you play mugen match 9? Who were the next door neighbors on the TV series Maude? Did Ice Cream flavored chewing gum ever exist? How many cats can you feed if you get three fourths of cat food and sixteen and one half of cat food? What is the LCM of 5and6and8? Who gives a persuasive speech at Caesar's funeral? What is the greatest common factor of 14 35 and 63? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? When was Edward Lawry Norton born? Whose court was birbal a minister in? Calibration of compass 1996 Dodge Ram 1500? Is mothball smell harmful to babies? Can you exercise while having an IUD? Is the white guy dead that played roach in next friday? Who was attila the hun's mother? Does nitrogen have a positive or negative charge?