answersLogoWhite

0

What are the First 3 common multiples 6 7 and 8?

User Avatar

Anonymous

∙ 8y ago
Updated: 8/21/2019

168, 336, 504.

User Avatar

Wiki User

∙ 8y ago
Copy

What else can I help you with?

Related Questions

What are the first 3 common multiples of 6 and 2?

First three common multiples of 2 and 6 are 6, 12 and 18.


What are the first 3 common multiples of 3 and 6?

6, 12, 18


What are the first three common multiples of 3?

They are: 3, 6 and 9


Common multiples of 3 and 6?

6,12,18 are the common multiples of 3 and 6


First 3 common multiples of 4 and 6?

76


What are the first 3 common multiples of 6 and7?

42,84,126


The first three common multiples of 3 and 6?

6, 12, 18


First three common multiples of 3 and 6?

6, 12 and 18


What is the first 3 common multiples of 2 and 3?

6, 12, 18


What are the first three common multiples of 1 and 3?

3, 6, 9


What are the three frist multiples of 3 and 9?

The first three multiples of 3 are 3, 6, 9 The first three multiples of 9 are 9, 18, 27 As the lowest common multiples of 3 and 9 is 9, the common multiples of 3 and 9 are the multiples of 9, thus: The first three common multiples of 3 and 9 are 9, 18, 27


What are the first common multiples of 3 6 and18?

The first three common multiples are 18, 36, and 54.

Trending Questions
Does Phobos have dirt or gravel? What happens if a tennis ball goes into a furnace? We were informed it will be corrected today. is this a correct sentence? Who said that saving the Union was more important than ending slavery? Which part of the QRS complex represents the repolarization of the atria? How can I safely access the roof using a ladder extension? What is the value of a Browning a 5 12 gauge shotgun made in the late 70's? How does the Chinese river dolphin protect itself? Does whipped cream give you a yeast infection? Are black and brown caterpillars poisonous? What was the role of the provincial congresses? Why do the hornets jerseys say bucs? How far is Roswell ga to Atlanta GA? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? What product code includes 18SX? Is the word of holy water Capitalized? Does stefan salvatore become good again? What is National Standards of School Counseling Programs? What reflection flips a point in a line? How is the diet going?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.