answersLogoWhite

0

What does 13 look like from a factor tree?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/17/2019

13 is already prime. It doesn't need a tree.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

What is the factor tree of 13 look like?

12


What does the factor tree of 65 look like?

65 / \ 13 5


What does the factor tree look like for 26?

26 / \ 2 13


What does the factor tree of 39 look like?

3 * 13 (both prime numbers)


What does a factor rainbow look like for 13?

13 is already prime. It doesn't need a rainbow.


What is the factor tree of 13?

13 is prime. No tree.


What is a factor tree for 13?

13 is a prime number so it doesn't have a factor tree.


What does the factor tree for 52 look like?

Oh, dude, a factor tree for 52? That's like a tree that shows how 52 can be broken down into its prime factors. So, you start with 52, then you can split it into 2 and 26, and then 2 and 13. It's like a family tree for numbers, but with less drama.


What is the factor tree for 78?

A factor tree of 78: 78 6 x 13 (2x3) x 13 Since 2, 3, and 13 are prime numbers, the factor tree is complete.


What is the factor tree for 13?

13 is already prime. It doesn't need a tree. 13 is prime. No tree.


What is the factor tree of 52?

The factor tree of 52 is 52 4 x 13 (2x2) x 13 The factor tree is finished. The prime factorization of 52 is 2 x 2 x 13.


What is a factor tree of 13?

13 is already prime. It doesn't need a tree.

Trending Questions
What do Egyptian peasants do for money? When did Victor Serge die? What is fee structure through nri cota in hbti? How do you find different words for the same meaning? What do the frederalist want with the constitution? Is low fat milk homogeneous or hetero? How many miles does a basketball player run to get in shape? When was the last time all of the planets aligned? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? Where do you find a mintmark? What are the physical properties of scissors? Is Didi games a safe place to play games? If a cake was divided equally between 4 people what percentage do hay get each? What is the leakage current of a conductor? What movie and television projects has William Humbert been in? Is a hello kitty boombox appropriate for a 6 year old little girl? How many pieces of jewelry were buried with King Tutankhamun? Is oxalocetic acid in the Krebs cycle? How wide is a column with 40 characters excel? Is CO2 an acid?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.