0
What else can I help you with?
Related Questions
How does six plus two equal sixty?
Six + ty = sixty.
What is the answer to three minus three times six plus two?
Three minus three times six plus two is equal to -13.
What is five elevenths plus two twenty two's equal?
six elevenths
What does two plus four equal?
4+2=6 Four plus two equals six.
What does negative four plus negative two equal?
negative six
What does seven plus six equal?
what does seven plus equal
What other numbers equal twelve?
Nought plus twelve. One plus eleven. Two plus ten. Three plus nine. Four plus eight. Five plus seven. Six plus six !
What does six plus six equal?
12 its 12
What is 2 and one third plus 3 and two thirds plus 4 and six ninths is equal to?
10 and 2/3.
What is two six equal to?
Two six is equal to 1/3
What does forty plus six equal?
forty + six = 46
What number plus six equal thirty six?
30
Trending Questions
Does trunks have kids?
Who created the IRS?
Can Windex clear up acne?
What is the union carpenter scale in North Dakota?
Is an authorized user of a credit card responsible for the debt after the account holder dies intestate without assets if all cash advances and purchases were made only for the holder's benefit?
How do you change the thermostat on a 2000 VW Passat?
Where have all prehistoric paintings been found?
What is ball ammunition?
Who is jack tar?
Why did northern and southern states argue over new states that entered the us?
Who gave birth to the devil?
Why are contrast and chiaroscuro an?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What was REM's most famous song?
What did Abigail do in act 4?
How big can a domestic turkey grow?
What ended slavery?
Can you get adulticide and microfilaricide to treat heartworms in your dog yourself?
What is lilys favorite color in The Secret Life of Bees?
How do i plug in a dodge diesel truck?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.