answersLogoWhite

0

What integer is bigger -9 or -18?

User Avatar

Anonymous

∙ 10y ago
Updated: 8/21/2019

9

User Avatar

Edward Lakin ∙

Lvl 10
∙ 4y ago
Copy

What else can I help you with?

Related Questions

What is a bigger integer -3 or -9?

6


What is the nearest integer to the square root of 18?

9


What does 18 and 9 go into?

9 after thinking about this... why would 18 go INTO 9... 18 is bigger and would be squished by 9


What is bigger a whole number or an integer?

For any integer, there is a whole number that is bigger, and for any whole number, there is a integer that is bigger.


What is bigger 2 over 9 or 1 over 6?

2/9 = 4/18 1/6 = 3/18 Therefore, 2/9 is bigger.


What is the smallest multiple of 9?

9 is the smallest multiple of 9. The smallest multiple of any integer is itself.


Which is bigger 7 over 18 or 5 over 9?

5/9 = 10/18 so, 5/9 > 7/18 ========


Why is 9 not divisible by 18?

Since 18 is bigger than 9, it cannot be stuffed into 9 even one time.


Is3 9 bigger or 6 18?

3/9 is equal to 6/18. 6/18 in its simplest form becomes 3/9.


Do any number that has 3 as a factor also has 9?

Any integer multiple of 9. For example 18, or 99.


What are the factors of 18 and 7?

The positive integer factors of 18 are: 1 2 3 6 9 18 The positive integer factors of 7 are: 1 7 Since 7 is a prime number, the only positive integer common factors of the two numbers is the number 1.


18 is what percent of 9?

If you want to find the percentage of a number you just divide the smaller number by the bigger number: 9 / 18 = .50 = 50%

Trending Questions
Is cinnamon sugar homogeneous mixture? Where is monk house uniform shop in Preston? How would you use contusion in a sentence? How many Oscars did All the 6 Harry Potter movies win in general? I love you in different language? How do cells of plants and fungi withstand very dilute external media without bursting? Which cell organelle is involved in membrane transformation? What is the bulkhead on a ship? What does kph mean? What is the oldest known Arthurian work? What kinds of patient samples are used for the purpose of identifying possible pathogens? What were the Railroad Wars''? What is the algebraic expression for product of c and 13? How do you spell stradegy? What is the significance of the practice statement? What are three minor characters in the book close to famous? Why weren't submarines used extensively prior to World War 1? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What gas do producers use for carbon to make sugars and starches? Why is spam considered to be inappropriate?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.