0
What else can I help you with?
Related Questions
What is 146 as a mixed number?
As a mixed number 1.46 = 1 and 46/100 or 1 and 23/50 simplified
What is the mixed number of 3 over 4?
3 over 4. There is no mixed number
What is 112 over 3 as a mixed number?
112 over 3 as a mixed number = 371/3
What is the mixed number of 83 over 3?
The mixed number of 83 over 3 = 272/3
What is 50 over 3 as a mixed number?
50 over 3 as a mixed number = 162/3
What is a mixed number for 11 over 3?
The mixed number for 11 over 3 is 32/3
What is the whole number or mixed number of 23 over 3?
The mixed number of 23 over 3 is 72/3
What is 16 over 3 as a mixed number?
3/16 can't be a mixed number however 16/3 as a mixed number is 51/3 if that's what you meant?
How do you write 14 over 3 as a mixed number?
14 over 3 as a mixed number = 42/3
How do you write 16 over 3 as a mixed number?
16 over 3 as a mixed number = 51/3
How do you write 25 over 3 as a mixed number?
25 over 3 as a mixed number = 81/3
What is 53 over 3 written as a mixed number?
53 over 3 written as a mixed number = 172/3
Trending Questions
What are the best months to visit Paraguay?
How many fps is a daisy model 120 break bearrel?
What is the difference between chelated magnesium and all the others?
What sounds are produced by these in matter?
When should the timing chain be replaced on a 2006 Toyota Matrix?
Who were the Hussites?
What do adult grass hoppers have what babies don't?
How many sides do 4 dodecagons 3 pentagons and 2 decagons have in all?
What detail is given to suggest that Hester prynne child was born in jail?
What if she recently broke up with her boyfriend and she wants to be just friends?
Is that Laurel Holloman in the Think Before You Speak-Cashier AdCouncil commercial?
How many oz of water does it take to fill a quart?
What is the fraction equivalent of 0.75?
You were driving your 1999 Lincoln town car and it lost engine power and shut off it will turn over but wont start what could this be?
What is the Job Description of a choreographer?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What is the area of a triangle if the base is 9 and the height is 27?
What are four sentences for the word reading?
What are some basic Judo throws?
Its hard to tell when horses of this color are dirty?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.