0
What else can I help you with?
Related Questions
What is 27 over 30 fractions in simplest form?
27/30 = 9/10
What is 30 over 81 to the simplest form?
30/81 simplifies to 10/27
What the simplest form 30 over 54?
30/54 = 15/27 = 5/9
What is 30 over 38 in simplest form?
30 over 38 in simplest form is 15 over 19.
What is the simplest form of 11 over 30?
11/30 is in its simplest form.
What is the simplest form for 13 over 30?
13/30 is in its simplest form.
18 30 in simplest form?
18 over 30 in its simplest form is three over five.
What is 30 over 5 in simplest form?
5 over 30 in simplest form is 1 over 6.
What is 30 over 11 in simplest form?
that is its simplest form
Is 13 over 30 in simplest form?
Yes 13/30 is in its simplest form
13 over 30 in simplest form?
13/30 is already in its simplest form
How can you write 7 over 30 in simplest form?
7/30 is in its simplest form.
Trending Questions
How are a lion and mountain lion different?
What is the atomic mass of argon in grams?
How long has Utah been a state in the USA?
Who are all the Dr. Who characters?
Why Do People Go Red When They Are Angry?
How much does a public relations person make?
When the time was right?
What does Mae Jemison fear?
Can silica make your skin itchy?
What properties do only gases have?
Why arnt there any mountains in Africa?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Will the bells ring if there is black smoke for the pope election?
Why are cars important to 13-year-olds?
What is nationality of actress portraying Pocahontas in movie the new world?
How will joey get married?
Where can one find an equity loan second mortgage?
What is the Lifeproof IPhone Headphone Adapter cord used for?
What do you do to get in labor?
Are children responsible for medical bills of a deceased parent when there is an estate or will?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.