0
5-60c in faruenhit = -55
What else can I help you with?
Trending Questions
What is mr beans real name?
What are Cristiano Ronaldo's body stats?
What is the mileage from Warsaw to Stalingrad?
What is the repetition of the same sounds or of the same kinds of sounds at the beginning of words or in stressed syllables?
What is the answer to Pandora's Box puzzle 136?
How can I efficiently paint doors to give them a fresh new look?
Extension of a range of ammeter using a current transformer?
Why is my cat always meowing?
Clothing - a social history of development?
Does the world economy depend on non-renewable energy sources?
What is the population of arzona?
What do a triangle a trapezoid and a pentagon have in common?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Why did Ray Bradbury use the idea of book burning in his novel Fahrenheit 451?
Can boric acid be used as a deodorant?
What actors and actresses appeared in Ma ma zai ai wo yi ci - 1988?
What is the wind speed of the great red spot?
What is 0.431 in simplest form?
What is Australia's altitude?
How much transmission fluid goes in filter 98 Saturn sw2?
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.