0
What else can I help you with?
Related Questions
What is 2 over 7 in its simplest form?
2 over 7 is the simplest form.
What is the simplest form for 7 over 8?
7 over 8 is in simplest form.
What is the simplest form of 15 over 7?
15/7 is in its simplest form.
What is three over seven in simplest form?
3/7 is in its simplest form.
What is 7 over 17 in simplest form?
7/17 is already in its simplest form
What is 7 over 25 in simplest form?
7/25 IS the simplest form Its the simplest form because 7 is prime.
Simplest form 7 over 42?
no,the simplest form for 7 over 42 is 1 over 6.
What is the simplest form of 4 over 7?
4/7 is in its simplest form.
What is 7 over 3 as a simplest form?
7/3 is in its simplest form.
What is 7 over 9 in its simplest form?
7/9 is in its simplest form.
7 over 4 in the simplest form?
7/4 is in its simplest form.
What is 7 over 12 in its simplest form?
7/12 is in its simplest form.
Trending Questions
Top school in Karachi?
What happen when you mix Robitussin an sprite?
What team holds the record for the most turnovers in an NFL game?
Were australians for or against World War 1?
Who wrote thatpeople can and should govern themselves?
What professional group governs the Central Reserve Depository Institutions?
What is the Politically correct way of saying deaf?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What was it about Franklin Delano Roosevelt that stunned Stalin and Churchill at the Yalta Conference in February of 1944?
Is happy hour at sonic everyday?
In a life estate does the owner of real property still own the property if he has quit claimed the property to the remaindermen?
Advantages of capital from profits?
Will a penny rust in apple juice?
What is a pooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo?
Komodo dragon is a snake true or false?
How much does it cost to service jet engine?
What is the processor executes instaction frequency?
Can you provide some melodic dictation examples for practice?
What is semto?
What are the important aspects of a responsible citizenship in education?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.