answersLogoWhite

0

What is 9845469064562?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/17/2019

nine trillion eight hundred forty five billion four hundred sixty nine million sixty four thousand five hundred sixty two

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions
Trending Questions
Is cinnamon sugar homogeneous mixture? Where is monk house uniform shop in Preston? How would you use contusion in a sentence? How many Oscars did All the 6 Harry Potter movies win in general? I love you in different language? How do cells of plants and fungi withstand very dilute external media without bursting? Which cell organelle is involved in membrane transformation? What is the bulkhead on a ship? What does kph mean? What is the oldest known Arthurian work? What kinds of patient samples are used for the purpose of identifying possible pathogens? What were the Railroad Wars''? What is the algebraic expression for product of c and 13? How do you spell stradegy? What is the significance of the practice statement? What are three minor characters in the book close to famous? Why weren't submarines used extensively prior to World War 1? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What gas do producers use for carbon to make sugars and starches? Why is spam considered to be inappropriate?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.