0
What else can I help you with?
Related Questions
What is the LCM of 4 and 8 and 64?
LCM of 4 8 and 64 is 64.
What is the LCM of 4 8 64?
It is: 64
What is the LCM for 8 and 64?
The LCM is: 64
What is the LCM of 64 and 8?
The LCM is: 64
Least common multiple of 8 and 4?
The least common multiple (LCM) of 8 and 4 is 8. Any time you have two numbers and the smaller number can go evenly into the bigger number the LCM will be the higher of the two numbers.I.e.12 and 24. LCM is 24.32 and 64. LCM is 64.
What is the least common multiple of 4 8 and 64?
The Least Common Multiple (LCM) of (4,8,64) is 64.
What is the LCM of 2 8 and 64?
64
What is the LCM and GCF of 36 and 64?
The GCF of 36 and 64 is 4 and their LCM is 576.
What 8 is the LCM of 4 and 8?
Since 8 is a multiple of 4, it is automatically the LCM.
What is the LCM of 23 and 8?
The LCM is 64. It goes 23 and then 64. When counting by eights it goes, 8, 16, 24, 32, 40, 48, 56, and then finally 64.
What is the LCM and GCF of 64 and 120?
The LCM is: 960 The GCF is: 8
What is the LCM of 8 16 32 64?
What is most common multiple of 16 8 64 32
Trending Questions
What is an example of paradoxes?
What part of an element determines its ability to combine with other elements?
How do you Manage copper levels in a hot tub?
Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person?
What kinds of credit cards allow one to apply online?
What should I do if my dog is tired and has a dry nose?
2 cups is equal to how many ml's?
50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution?
Who was Athena' rival in the city-state?
What is a recipe from colonial Rhode Island?
Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK?
What is P0153 codes on Toyota Sienna 3.0 engine?
Which concept did the Maya understand before europeans?
What is 12times 8?
Does Jon Gruden still get paid from the buccaneers?
How can I find a replacement head for my Kobalt weed eater?
Why is my kitten growling while playing?
How do you define global environmental scan.?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What happened to st therese of lisieux when she was 4?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.