0
What else can I help you with?
Related Questions
Who invented Archimedes' screw?
Archimedes invented Archimedes' screw.
Archimedes did not what?
One of the things that Archimedes did not do is that Archimedes did not write Elements of Geometry.
Was Archimedes know for the Nobel Prize or something named after him?
Archimedes didnt get Nobel prize. Some of his discoveries / inventions are: Archimedes principle, Archimedes screw, claw of Archimedes.
What was Archimedes origin?
What is Archimedes origin?
Is Archimedes Archimedes' real name?
He is only known as Archimedes of Syracuse ( now Sicily).
What is the birth name of Archimedes Patti?
Archimedes Patti's birth name is Archimedes L.A. Patti.
What did Archimedes studied?
Archimedes studied astronomy, engineering, mathematics, and war tactics.
What is the Archimedes pulley?
a pulley that Archimedes made
Is Aristotle more famous then Archimedes?
Archimedes
Was Archimedes an inventor?
Yes, Archimedes was an inventor.
What awards was Archimedes given?
what was archimedes arwared
Who was Archimedes's employer at his time?
Who was archimedes employer
Trending Questions
What do Egyptian peasants do for money?
When did Victor Serge die?
What is fee structure through nri cota in hbti?
How do you find different words for the same meaning?
What do the frederalist want with the constitution?
Is low fat milk homogeneous or hetero?
How many miles does a basketball player run to get in shape?
When was the last time all of the planets aligned?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Where do you find a mintmark?
What are the physical properties of scissors?
Is Didi games a safe place to play games?
If a cake was divided equally between 4 people what percentage do hay get each?
What is the leakage current of a conductor?
What movie and television projects has William Humbert been in?
Is a hello kitty boombox appropriate for a 6 year old little girl?
How many pieces of jewelry were buried with King Tutankhamun?
Is oxalocetic acid in the Krebs cycle?
How wide is a column with 40 characters excel?
Is CO2 an acid?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.