0
What else can I help you with?
Related Questions
What is a factor tree of 76 answer?
76= 2•2•19
What is a prime number factor tree 76?
76 38,2 19,2,2
What is a factor tree of 76?
38,2 19,2,2
what is the Prime factor of 76 using factor tree?
I can't draw a factor tree here 76 / 2 = 38 38 / 2 = 19 Prime factorization is 2, 2, 19
What factor is paired with 38 to give 76?
what factor is paired with 38 to give 76
What is greatest common factor of 38 and 76?
The greatest common factor of 38 and 76 is 38.
What is the greatest common factor of 76 and 84?
The greatest common factor of 76 and 84 is 4.
What is the greatest common factor of 2 76?
The greatest common factor of 2 , 76 = 2
What is the greatest common factor of 76 and 112?
The greatest common factor of 76 , 112 = 4
What is the greatest common factor of 76 38?
Since 38 is a factor of 76, it is automatically the GCF.
What is the common factor of 38 and 76?
Since 38 is a factor of 76, all of its factors are common.
What is the factorization tree for 76?
76 38,2 19,2,2
Trending Questions
What do Egyptian peasants do for money?
When did Victor Serge die?
What is fee structure through nri cota in hbti?
How do you find different words for the same meaning?
What do the frederalist want with the constitution?
Is low fat milk homogeneous or hetero?
How many miles does a basketball player run to get in shape?
When was the last time all of the planets aligned?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Where do you find a mintmark?
What are the physical properties of scissors?
Is Didi games a safe place to play games?
If a cake was divided equally between 4 people what percentage do hay get each?
What is the leakage current of a conductor?
What movie and television projects has William Humbert been in?
Is a hello kitty boombox appropriate for a 6 year old little girl?
How many pieces of jewelry were buried with King Tutankhamun?
Is oxalocetic acid in the Krebs cycle?
How wide is a column with 40 characters excel?
Is CO2 an acid?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.