0
What else can I help you with?
Related Questions
What is the greatest common factors of 2666 and 86?
The GCF is 86.
What is the GCF of 86 and 100?
The GCF is 2.
What is the GCF of 86 and 36?
The GCF of 86 and 36 is 2.
What is the greatest common factor of 86 75 and 20?
The GCF is 5.
What is the GCF of 86 84 and 48?
The GCF is 2.
Gcf of 76 and 86?
Gcf =2 76-1,2,4,19,38,76 86-1,2,43,86
Is 3 the gcf of 42 and 86?
No.86 does not divide by 3...The GCF = 2
What is the GCF of 43 and 86?
Since 43 is a factor of 86, it is automatically the GCF.
What is the GCF of 76 and 86?
The GCF is 2.
What is the GCF of 86 and 200?
The GCF is: 2
What is the gcf of 86 and 105?
The GCF is: 1
What is the gcf of 86 and 46?
The GCF is 2.
Trending Questions
How are a lion and mountain lion different?
What is the atomic mass of argon in grams?
How long has Utah been a state in the USA?
Who are all the Dr. Who characters?
Why Do People Go Red When They Are Angry?
How much does a public relations person make?
When the time was right?
What does Mae Jemison fear?
Can silica make your skin itchy?
What properties do only gases have?
Why arnt there any mountains in Africa?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Will the bells ring if there is black smoke for the pope election?
Why are cars important to 13-year-olds?
What is nationality of actress portraying Pocahontas in movie the new world?
How will joey get married?
Where can one find an equity loan second mortgage?
What is the Lifeproof IPhone Headphone Adapter cord used for?
What do you do to get in labor?
Are children responsible for medical bills of a deceased parent when there is an estate or will?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.