Math and Arithmetic

Literature and Language

Law & Legal Issues

Business & Finance

Leaderboard Related Topics

Math and Arithmetic

0

Factoring and Multiples

What is the LCM 14 and 42?

Wiki User

∙ 2015-07-28 14:27:15

Best Answer

It is: 42

Wiki User

∙ 2015-07-28 14:27:15

This answer is:

🙏

0

🤨

0

😮

0

Study guides

Algebra

A polynomial of degree zero is a constant term

The grouping method of factoring can still be used when only some of the terms share a common factor A True B False

The sum or difference of p and q is the of the x-term in the trinomial

A number a power of a variable or a product of the two is a monomial while a polynomial is the of monomials

➡️

See all cards

Factoring and Multiples

What is the prime factorization of 24

What is the prime factorization of 54

What is the prime factorization of 64

What is the prime factorization of 34

➡️

See all cards

Factoring and Multiples

What are the particles of matter

Particles of matter move slower as the matter is heated

What are the common factors of 32 and 54

Factors of 325

➡️

See all cards

Add your answer:

Earn +20 pts

Q: What is the LCM 14 and 42?

Write your answer...

Submit

Related questions

What is the Lcm of 14 and 42?

LCM(14, 42) = 42

What is the LCM for 6 and 14?

The LCM is 42.

What are the LCM for 14 and 42?

The LCM is 42.

What is the LCM of 14 28 42?

LCM of 14 28 42 is 84.

What is the lcm of 7 14 42?

The Least Common Multiple (LCM) of 7, 14, and, 42 is 42.

What is the LCM for 3 6 and 14?

The LCM is 42.

What is the lcm of 42 and 14?

42. 14 is a factor of 42.

What is the LCM for numbers 14 and 42?

The LCM is 42.

LCM of 14 and 42?

The LCM is: 42

What is the LCM for 14 and 42?

The LCM is: 42

What is the lowest LCM for 14 and 21?

LCM for 14 and 21 is 42.

What is the LCM of 14 21and 42?

The LCM is: 42

What is the LCM of 14 21 and 42?

The LCM is: 42

What is LCM of 6 and 14?

The LCM of 6 and 14 is 42.

What is the LCM of 21 14?

The LCM of 14 and 21 is 42.

LCM of 3 7 14?

LCM (3, 7, 14) = 42.

What is the LCM of 7 14 and 42?

Least Common Multiple (LCM) for 7 14 42 is 42.

Need a example for fractions LCM 14.42?

The LCM of 14 and 42 is 42.

What the LCM of 6 and 14?

The LCM is 42.

LCM of 6 and 14?

The LCM of 6 & 14 is 42

What is the LCM od 14 7 and 21?

The LCM is 42.

What is the LCM of 7 42 and 14?

42

What is the LCM of 7 42 14?

42

What is the LCM of 2 6 and 14?

The LCM of 2, 6 and 14 is 42.

What is the LCM of 6 7 and 14?

LCM of 6, 7, and 14 = 42

Study Guides

Created By Hulda Gleason

Factoring and Multiples

Created By Leland Grant

Factoring and Multiples

Created By Carlee Ferry

Math and Arithmetic

Created By Willy Quitzon

Trending Questions

what level of fitness do officials need in rounders?

Asked By Bethany Blount-Jones

What are the pros of not getting married to a man?

Asked By Mahmoud Warith

: which of the following would not be considered a non-traditional sport apex?

Asked By Joebert Escorial

How sports bring people together essay?

Asked By Ultra Ghotzs

What are the communication features available to participants?

What are tattoos?

Asked By Shauna Mobley

Ok what year i started high school?

Asked By Crystal Adams

Will mastubating 5+ times per day make me taller?

Still have questions?

imp

Previously Viewed

What is the LCM 14 and 42?

Asked By Wiki User

Unanswered Questions

What is the matching mRNA sequence for tactcgccggtattagacgtt?

Asked By Lil Don Harris

Would you like to have Entertainment and fun in your life?

Asked By Kolkata

What are the x and y intercepts for y=x^2-2x+2?

Asked By Serenity Now

what topic or theme do all three poems in the reading have in common?

Asked By Anastazia mcleod

if you were stranded in the sea what would you do?

Asked By ALEXANDRA CID

What if the shape of the egg is square?

Asked By Mum lance

What will happen if human beings never stop growing?

Asked By Mum lance

Is it possible for males to be pragnent?

Asked By Mum lance

Company

Product

Legal

Get the Answers App

Android App Download

Made with 💙 in St. Louis

Copyright ©2021 Answers, LLC. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.