answersLogoWhite

0

What is the factorization of 914?

User Avatar

Anonymous

∙ 15y ago
Updated: 10/17/2024
Factorization of 914

1 X 914

2 X 457

457 is a Prime number (only divisible by 1 and itself), so it cannot be factored farther.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

What is the prime factorization of 914?

914 = 2 x 457


What is prime factorization of 914?

2 x 457


What is 914 - 37?

914 - 37 = 877


What are the factors of 914?

There are infinitely many possible answers. An easy one to figure out is 1 times 914.


What is half of 914?

914 / 2 is equal to 457.


What is the cube root of 914?

The cube root of 914 = 9.704699


What numbers go into 914?

1, 2, 457, 914.


How many ounces are in 914 centiliters?

914 centiliters converts to about 309 US fluid ounces.


What does 914 divided by 2 equals?

457


How many inches are in 914 mm?

914 mm = 35.98 inches (rounded)


How many feet is 914 meters?

914 metres = 2998.7 feet (approx).


What are the factors and prime factors of 914?

The prime factors of 904 are: 2, 113

Trending Questions
WHAT CLOTHES SHOULD YOU BRING FOR JUPITER? Is the lead singer in 3oh3 a Christian? Do birds on a telephone line wire indicate the coming of rain? Is the lead singer of Avenged Sevenfold Jewish? Where can you play mugen match 9? Who were the next door neighbors on the TV series Maude? Did Ice Cream flavored chewing gum ever exist? How many cats can you feed if you get three fourths of cat food and sixteen and one half of cat food? What is the LCM of 5and6and8? Who gives a persuasive speech at Caesar's funeral? What is the greatest common factor of 14 35 and 63? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? When was Edward Lawry Norton born? Whose court was birbal a minister in? Calibration of compass 1996 Dodge Ram 1500? Is mothball smell harmful to babies? Can you exercise while having an IUD? Is the white guy dead that played roach in next friday? Who was attila the hun's mother? Does nitrogen have a positive or negative charge?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.