0
What else can I help you with?
Related Questions
What is the GCF of 288 and 216?
The GCF is 72.
What is the GCF of 62 and 162?
The GCF is 2.
What is the GCF of 162 and 50?
The GCF is 2.
What is the GCF of 216 and 450?
The GCF is 18.
What is the GCF of 218 and 216?
The GCF is 2.
What is the GCF of 216 and 612?
The GCF is 36.
What is the GCF of 216 and 42?
The GCF is 6.
What is the GCF of 216 and 4675?
gcf(216, 4675) = 1.
What is the gcf of 216 and 144?
The GCF is 72.
What is the GCF of 18 and 216?
Since 18 is a factor of 216, it is automatically the GCF.
What is the GCF of 24 and 216?
Since 24 is a factor of 216, it is automatically the GCF.
What is the GCF of 216 and 234?
The GCF is 18.
Trending Questions
What is an example of paradoxes?
What part of an element determines its ability to combine with other elements?
How do you Manage copper levels in a hot tub?
Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person?
What kinds of credit cards allow one to apply online?
What should I do if my dog is tired and has a dry nose?
2 cups is equal to how many ml's?
50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution?
Who was Athena' rival in the city-state?
What is a recipe from colonial Rhode Island?
Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK?
What is P0153 codes on Toyota Sienna 3.0 engine?
Which concept did the Maya understand before europeans?
What is 12times 8?
Does Jon Gruden still get paid from the buccaneers?
How can I find a replacement head for my Kobalt weed eater?
Why is my kitten growling while playing?
How do you define global environmental scan.?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What happened to st therese of lisieux when she was 4?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.