0
What else can I help you with?
Related Questions
What is Greatest commons factor for 18and 32?
The GCF is 2.
What is the greatest common factor of 60 and 2?
the greatest common factor for 60 and 2 is 1
What is the greatest common factor of 38 and 4?
The greatest common factor is 2
What is the greatest common factor for 12 and 10?
The Greatest Common Factor of 12 and 10 is 2.
What is the greatest common factor of 2 and 4a?
Since 2 is a factor of 4a and the largest factor of 2 is 2, and thus the greatest common factor cannot be larger than 2, the greatest common factor is 2.
Greatest common factor of 2 and 8?
The greatest common factor of 2 and 8 is 2
What is the greatest common factor of 2 and 24?
The Greatest Common Factor (GCF) is: 2
What is the greatest common factor of 2 76?
The greatest common factor of 2 , 76 = 2
What is the greatest common factor of 48 and 2?
The Greatest Common Factor (GCF) is: 2.
What is the greatest common factor of 2 and 16?
greatest common factor of 2 and 16 is 2.
What is the Greatest Common Factor of 80 and 54?
The greatest common factor of 54 and 80 is 2
What is the greatest common factor of 48 and 34?
The greatest common factor of 34 and 48 is 2.
Trending Questions
Is cinnamon sugar homogeneous mixture?
Where is monk house uniform shop in Preston?
How would you use contusion in a sentence?
How many Oscars did All the 6 Harry Potter movies win in general?
I love you in different language?
How do cells of plants and fungi withstand very dilute external media without bursting?
Which cell organelle is involved in membrane transformation?
What is the bulkhead on a ship?
What does kph mean?
What is the oldest known Arthurian work?
What kinds of patient samples are used for the purpose of identifying possible pathogens?
What were the Railroad Wars''?
What is the algebraic expression for product of c and 13?
How do you spell stradegy?
What is the significance of the practice statement?
What are three minor characters in the book close to famous?
Why weren't submarines used extensively prior to World War 1?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What gas do producers use for carbon to make sugars and starches?
Why is spam considered to be inappropriate?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.