0
What else can I help you with?
Related Questions
What is the greatest common factor of 20 12and 30?
It is: 2
What is the greatest common factor of 10 12and 24?
The GCF is 2.
What is the greatest common factor of 60 and 2?
the greatest common factor for 60 and 2 is 1
What is the greatest common factor of 38 and 4?
The greatest common factor is 2
What is the greatest common factor for 12 and 10?
The Greatest Common Factor of 12 and 10 is 2.
What is the greatest common factor of 2 and 4a?
Since 2 is a factor of 4a and the largest factor of 2 is 2, and thus the greatest common factor cannot be larger than 2, the greatest common factor is 2.
Greatest common factor of 2 and 8?
The greatest common factor of 2 and 8 is 2
What is the greatest common factor of 2 and 24?
The Greatest Common Factor (GCF) is: 2
What is the greatest common factor of 2 76?
The greatest common factor of 2 , 76 = 2
What is the greatest common factor of 48 and 2?
The Greatest Common Factor (GCF) is: 2.
What is the greatest common factor of 2 and 16?
greatest common factor of 2 and 16 is 2.
What is the Greatest Common Factor of 80 and 54?
The greatest common factor of 54 and 80 is 2
Trending Questions
How are a lion and mountain lion different?
What is the atomic mass of argon in grams?
How long has Utah been a state in the USA?
Who are all the Dr. Who characters?
Why Do People Go Red When They Are Angry?
How much does a public relations person make?
When the time was right?
What does Mae Jemison fear?
Can silica make your skin itchy?
What properties do only gases have?
Why arnt there any mountains in Africa?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Will the bells ring if there is black smoke for the pope election?
Why are cars important to 13-year-olds?
What is nationality of actress portraying Pocahontas in movie the new world?
How will joey get married?
Where can one find an equity loan second mortgage?
What is the Lifeproof IPhone Headphone Adapter cord used for?
What do you do to get in labor?
Are children responsible for medical bills of a deceased parent when there is an estate or will?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.