answersLogoWhite

0

What is the largest common multiple of 4 20?

User Avatar

Anonymous

∙ 8y ago
Updated: 8/21/2019

It is infinity but the lowest common multiple of 4 and 20 is 20

User Avatar

Wiki User

∙ 8y ago
Copy

What else can I help you with?

Related Questions

What is the least common multiple for 20 and 4?

The Least Common Multiple (LCM) for 20 4 is 20.


Least common multiple of 4 and 20?

Because 20 is divisible by 4, the least common multiple of 4 and 20 is 20.


What is the least common multiple of 4 10 20?

The Least Common Multiple (LCM) of 4, 10, and 20 is 20.


What is the least common multiple of 4 6 and 20?

The least common multiple of 4 , 6 , 20 = 60


What is the least common multiple of 19 4 and 20?

The least common multiple of 19 , 4 , 20 = 380


Find the least common multiple of 20 5 and 4?

The least common multiple of 20 5 and 4 is equal to 20.


What is the least common multiple of 4 and 5 and 10?

least common multiple of 4 and 5 and 10 IS 20


What is the greatest common multiple of 8 and 20?

The greatest common multiple of 8 and 20 is 4.


What is the least common multiple of 4 20 and 24?

The Least Common Multiple (LCM) of (4, 20 and 24) is 120.


What is the least common multiple of 4 20 36?

least common multiple of 4 20 36 is 180.


What is the least common multiple of 20 4 and 16?

The Least Common Multiple (LCM) for 4 16 and 20 is 80.


What is the lowest common multiple of 5 and 4?

20.20The LCM of 4 and 5 is 20.

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.