answersLogoWhite

0

What is the name of the answer of a multiplication problem?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/16/2019

The answer to a multiplication problem is called the product.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

What is the name for the answer in a multitplication problem?

The name for the answer in a multiplication problem is product.


What is the name of an answer to a multiplication problem?

Solution.


What is the name of the answer to a multiplication problem?

Product


What is the name for the answer called in a multiplucation problem?

the name for the answer to a multiplication problem is called the product.


What is the name for the result in a multiplication problem?

The product


What is the name of the asnwer to a multiplication problem?

the product


What is the name for the answer in a multiplication problem?

the product (the product of 3x4=12)


Name the parts of a multiplication problem?

Multiplicand Multiplier Product


What is the name of property that reveres a problem?

The inverse of division is multiplication


What do you call an answer to a multiplication problem?

A product is an answer to a multiplication problem.


How can you end a multiplication word problem?

The answer to a multiplication problem is the product.


What is thew answer to multiplication problem?

the multiplication of two numbers is called a factor the answer to a multiplication problem is called a product

Trending Questions
How can I spend more time with horses if I dont have my own? What is b squared to 100? Who settled the colony of caralina? What answer did shadrack make to the unasked question? What is the names of all jls members? Sharp atomic clock SPC373 can not get your outside temp to set? What is the origin of wig? What steps did Lincoln take to preserve the union before and after the fighting at fort Sumter? What are the best techniques for applying whitewash paint to brick surfaces? 96 mercury mystique fuse configuration? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do crafts help in school? What do the bells do in the plaza in Kirby's epic yarn? What did the Byzantine empire do to control the Roman Empire? Can a pastor have someone committed? What are some famous people that begin with the letter z? What is controllable and uncontrollable cost? Where can you have an outdoor outing in Rhode Island? Where is the Oxygen sensor on a 1997 4runner? What movies has Anna popplewell starred in?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.