answersLogoWhite

0

What numbers are divisible by 260?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/19/2019

All multiples of 260 (which are infinite) including 260, 520, 780, 1040, 1300 . . .

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What is evenly divisible by 260?

Just multiply 260 by numbers: 520 (2x), 780 (3x), etc.


Is 4 divisible by 260?

No, 4 is smaller than 260. But 260 is divisible by 4.


What is 260 divisible by?

It is divisible by 2.


Is 3 divisible by 1 260?

Is it divisible


Is 3 divisible by 260?

No.


Name athe numbers between 200 and 300 that is divisible by 13?

208, 221, 234, 247, 260, 273, 286, 299


Which numbers are divisible?

All numbers are divisible by 1.


How many numbers between 200 and 300 are such which are divisible by 13?

208, 221, 234, 247, 260, 273, 286, 299 We count 8.


What is the smallest number divisible by 20 and 13?

260


Why are prime numbers divisible?

Prime numbers are divisible because any numbers that are divisible are prime. If a number isn't divisible, it isn't prime. Prime numbers have to be divisible by at least one pair of numbers to be prime.


260 divisible by 10?

Yes. The result is 26. any number ending in zero is divisible by 10.


Is 780 divisible by 3?

Yes, 780 is divisible by 3. You get a whole number. 780/3=260

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.