answersLogoWhite

0

What percent is 120 in 150?

User Avatar

Anonymous

∙ 10y ago
Updated: 10/17/2024

120 as a percentage of 150 is 80%

User Avatar

Wiki User

∙ 10y ago
Copy

What else can I help you with?

Related Questions

What are the answers to these 120 percent of 80 80 percent of 120 70 percent of 150 150 percent of 200 200 percent of 150?

120% of 80 = 96 80% of 120 = 96 70% of 150 = 105 150% of 200 = 300 200% of 150 = 300


150 volts is what percent of 120 volts?

150 / 120 = 1.251.25 x 100 = 125answer:125%150 volts is 125 percent of 120 volts.


Which is greater 15 percent of 120 or 12 percent of 150?

15% of 120 is equal to 12% of 150. 15% of 120 = 18 12% of 150 = 18


What is 120 percent of 150?

120% of 150 = 120% * 150 = 1.2 * 150 = 180


How do you find the percent of 120 multiply by 150?

18000


What is the percent of 180 out of 120?

150%


What is the25 percent markup of 120?

To calculate a 25 percent markup on 120, first find 25 percent of 120, which is 30 (0.25 × 120 = 30). Then, add this amount to the original price: 120 + 30 = 150. Therefore, the price after a 25 percent markup on 120 is 150.


What numbet is 150 percent of 80?

150% of 80 is 120.


What is 125 percent of 120?

125% of 120= 125% * 120= 1.25 * 120= 150


What it 80 percent of 150?

80% of 150 = 80% * 150 = 0.8 * 150 = 120


Percent increase from 120 to 150?

25 percent increase.


What is 20 percent off of 150 pounds?

150 x (1 - 20/100) = 150 x 0.8 = 120 Therefore, 20 percent off 150 pounds is 120 pounds.

Trending Questions
Ano ang klaseng pagkain ang bawal na pagkain sa pusa? How common are Ehlers Danlos syndromes? What was the name of the first motor car? Are there bugs on my skin? What does devoted to a religion mean? What is writing a fraction as an equivalent fraction with a larger denominator called? What is 70 percent of 630? Are Mario and Chris rock brothers? Why are there no nerve endings in articular cartilage? What age is Jo brand? How much does a 2004 ferrari enzo cost? How can you mine in Minecraft Pocket Editon? Are you mad or nah? Why did john Adams asserted that Jefferson plagiarized the declaration of independence from the works of which philosopher? When does dratini evolve into a dragonair in Pokemon leaf green? What is a quarter to seven? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? What is the Royal Danish Ballet's Website? What is the length of a triangle that has a 40 inch hypotnuse and a 90 degree angle? What is the correct spelling of the singular possessive form of falcons?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.