0
What else can I help you with?
Related Questions
What are two fractions equal to two fifths?
answer are 4 tenths and 8 20ths
What does two eighths equal to in Fractions?
2/8 = 1/4
What two fractions are equivalent to a half?
There are endless fractions that are equal to 1/2, but two of them could be 2/4 and 4/8.
What are two fractions equivalent to four sevenths?
Two examples of fractions that 4/7 is equal to are 8/14 and 12/21.
What are 2 equal fractions for two fifths?
4/10 8/20
What two fractions equal 75 percent?
3/4 and 6/8
What are two equal equivalent fractions to one-fourth?
2/8, 3/12
What are the fractions between 8 10ths and 5 4ths?
There are no fractions between 8/10s and 4/5s because those fractions are equal. In decimal form they equal .8
What 2 fractions equal 3 over 8?
30/80 and 333/888 are two example.
What are 3 equivalent fractions equal to two thirds?
4/6 6/9 8/12
Fractions what does 3 out of 8 equal to?
0.375
Why do two multiplied fractions equal a lower number than both fractions?
so say you were multiplying 8 bye 2 it would equal 8 two times right? well, multipliying a whole number by a fraction is the same. if you times 8 by 1/2 it would be 8 a half a time (4) hope i helped ;)
Trending Questions
Top school in Karachi?
What happen when you mix Robitussin an sprite?
What team holds the record for the most turnovers in an NFL game?
Were australians for or against World War 1?
Who wrote thatpeople can and should govern themselves?
What professional group governs the Central Reserve Depository Institutions?
What is the Politically correct way of saying deaf?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What was it about Franklin Delano Roosevelt that stunned Stalin and Churchill at the Yalta Conference in February of 1944?
Is happy hour at sonic everyday?
In a life estate does the owner of real property still own the property if he has quit claimed the property to the remaindermen?
Advantages of capital from profits?
Will a penny rust in apple juice?
What is a pooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo?
Komodo dragon is a snake true or false?
How much does it cost to service jet engine?
What is the processor executes instaction frequency?
Can you provide some melodic dictation examples for practice?
What is semto?
What are the important aspects of a responsible citizenship in education?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.