

Best Answer

Consecutive terms in the sequence are being divided by -2. Therefore, -1 / -2 = 1/2 or 0.5.

User Avatar

Wiki User

โˆ™ 2010-10-21 20:36:42
This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: Which number should come next in the following sequence 8 -4 2 -1?
Write your answer...
Related questions

What number should come next in the following sequence 18 21 17 20 16 19 15?


What number should come next in the following sequence 18211720161915?


Which number should come next in the following sequence 243-81-27-9?

3 Each term is divided by 3 to produce the following term.

Which number should come at the end of the series 1 4 9 16?

The next number is 25 but there are the sequence is infinite so there can be no end to the sequence.

What number should come next in the following sequence 4-15-24-35?

44. You're adding 11 then 9 each time !

Which number should come next in the following sequence 2-6-3-8-6-12?

The sequence indicates that one number is added to the previous number to find the value of the next number. Example 1 (+0) - 1 (+1) - 2 (+1) - 3 (+2) - 5 (+3) - 8 (+5) - 13. The next number in the sequence would be 21 (13 + 8).

Do grapes come under Fibonacci sequence?

No. Grapes have nothing to do with a recursive series of numbers following the rule that any number is the sum of the previous two.

What number come number after 1 4 16?

The next number in the sequence is... 64

Which number should come next in the following sequence 2 3 5 10?

0 + 2 + 3 = 5 2 + 3 + 5 = 10 3 + 5 + 10 = 18 5 + 10 + 18 = 33

What number would come next in this sequence 98 34 14 10?


Which number should come next 3-5-8-13-21?

This is a Fibonacci sequence. Each number in the sequence is the sum of the previous two numbers:3+5=85+8=138+13=2113+21=34

What number should come next in the sequence 72 69 64 57 48?

37: How? Every time a new number is put into the sequence, when you subtract it from the number before it, it will equal an odd number of greater value. For example; 72-69=3 69-64=5 64-57=7 57-48=9 48-37=11

MRNA sequence augccaaaaauugcgacuuag was transcribed from what DNA sequence?

That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.

What is the next number in the sequence It seems that the sequence takes the doubled numbers than adds two to the said number, such as five. So with that theory it would be logical that six would come after the doubled fours.

Is the word follow a noun?

No, the word follow is a verb (follow, follows, following, followed), to come after in sequence, to go after someone or something. The noun forms for the verb to follow are follower and the gerund, following.

What number sequence comes after 31 40 41 47 48 45?

It is impossible to say what sequence comes after the given set of numbers. What I can do is to suggest what number might come next in the given sequence.Using the ruleUn = (7n5 - 129n4 + 891n3 - 2859n2 + 4298n - 1488)/24 for n = 1, 2, 3, ...the next number is 85.

What number should come next in the following sequence 6 9 8 11 10 13 12?

The sequence goes (starting from the six): Up 3: 6 + 3 = 9 Then you subtract 1: 9 - 1 = 8 Then you add 3 again: 8 + 3 = 11 then subtract 1 again: 11 - 1 = 10 The sequence is up 3, minus 1. You subtract 1 from 13 to get the 12, then you have to add 3 again. 12 + 3 = 15 15 comes next. Hope I helped! - Darg

What number should come next -9 16 -25?

These are square numbers of 3, 4, 5 with alternating sign, I'd expect to continue the sequence with 36, -49, 64, -81, 100

What number should come in deshawar on today?


The number which best completes the sequence 1.5 5 10.5 18?

The next number is 27.5. begin by subtracting the first two then add 2 to the answer each time to come up with the next number

What is a list of numbers which come in a particular order?

A sequence.

What numbers come next in this series 0 2 1 3 2 4 3?

The next four number in the sequence are... 4,5,5 & 6

What is the next number in this sequence 7 11 13 21 25 41 49?

Any number can come next in the sequence. Given ANY number, it is possible to find a polynomial of order 7 that will generate the above numbers and the chsen extra number. And polynomials are not the only kind of functions. However, the polynomial of order 6 that will fit these data is Un = (-53n6 + 1245n5 - 11525n4 + 53355n3 - 128462n2 + 150960n - 63000)/360 for n = 1, 2, 3, ... and, accordingly, the next number in the sequence is -175.

You've come across a book in the card catalog that you think will be useful in your research of famous labor leaders What three things should you copy from the card so that you know how to find it?

The author's name, the title of the book, and the call number (the number/letter sequence on spine of book), so you can locate it in the library.

From which food group should the largest number of servings in your diet come?

The largest number of servings should come from the Bread, Cereal, Grains, and Rice family. 6-11 servings daily are recommended.