0
What else can I help you with?
Related Questions
How do you write one and thrity-four hundredths in standard form?
1.34
How do you write the number four and thirty-six hundredth in standard form?
4.36
How do you write one hundred and one hundredth in standard form?
You write one hundred and one hundredth in standard form as 1.0001 × 102
How do you write four hundred and thrity nine thousandths in number form?
It is 400.039
How do you write fifty-two and one hundredth in standard form?
Fifty-two and one hundredth in standard form is 52.01
How do you write fourteen hundredth in standard form?
0.14
How do you write 6 and 4 hundredths in standard form?
6 hundred 6 hundredth - 4 hundredth
How do you write five and five hundredth five thousandths in standard form?
It is 5.055
How do you write thrity hundredths in decimal form?
0.36
How do you write in standard form six thousand and one hundredth?
The standard form is 6,000.01
How do write this in standard form six thousand and one hundredth?
6,ooo.01
How do you write three hundredth in standard form?
Three hundredths (0.03) in standard form is 3.0 × 10-2
Trending Questions
What document approved by 13 states was established the first government in 1781?
Longest wavelength in the spectrum of color?
What was the most important medium for Tin Pan Alley songs at the turn of the Century?
What does the name Safora mean?
What is the definition of a quarter moon?
What is the centre of culture?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
Who was the commanding officer union during the battle of Gettysburg?
Is the radium Paint in a compass dangerous?
How do you pronounce the brand of sunglasses called Costa?
Did the Philippines fight in World War 2?
Hindu goddess of the Earth?
What could be considered a reliable source of scientific information?
How did rev run and kid rock become friends?
Which dosage is stronger 160 mcg or 220 mcg?
Who said liberty consists in doing what one desires?
Which religious group primarily settled in Pennsylvania?
How do you get off the help menu pokemon fire red pc?
Can Catholics be single?
Why is there no power to the ignition switch?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.