answersLogoWhite

0

Trap primer is connected to domestic cold water line close to a fixture. Trap primer water line runs to a DWV trap made for trap primer usage.

User Avatar

Wiki User

14y ago

What else can I help you with?

Continue Learning about Educational Theory

Was the alliance system good or bad?

The alliance system had both positive and negative consequences. On the positive side, alliances could provide security and mutual defense for member nations. However, they also increased the likelihood of conflict by creating a complex web of obligations that could drag multiple countries into a war. Ultimately, the alliance system contributed to the escalation of World War I.


What causes error code P505?

Error code P0505 typically indicates a fault with the idle air control system. This could be due to a faulty idle air control valve, a vacuum leak, or a problem with the throttle body. It is recommended to have the system inspected by a mechanic to diagnose and repair the issue.


What are the differences between a use-case diagram and use case?

Use Case diagrams are behavior diagrams of UML used to describe a set of actions (Use Cases) that some system or systems (Subject) should or can perform in collaboration with one or more external users of the system (Actors).Each Use Case describes a unit of complete and useful functionality, some observable and valuable result that the subject provides to its users (actors)or other stakeholders of the system.Example use cases for bank ATM are: Withdraw Cash, Make Deposit.Use case diagram for ATM could show users of ATM, some or all of use cases, boundary of the system. See example in provided link.


Was the paddle wheel for energy?

A paddle wheel can generate energy if it is turned by a river or some other method of propulsion. Hydro-electric power uses turbines, which are just fancy paddle wheels. On the other hand, a paddlewheel can push a boat, if it is powered by steam.


Should schools provide day care for their students with children?

I wouldn't like to put the onus on the Educational System, but it's a good idea, so all single moms should be willing to organize something and provide the costs for this without involving the tax payers or expect the Educational System to pick up the tab. Sweden has many companies that have day care for their children, but pay a small fee. It works! I wish they would do more of this in the U.S. and Canada. Our Day Cares here are extremely expensive and it's hardly worth the single parent going to work. So it costs more in the long run.

Related Questions

Why does your paint not stick to the primer on the wall The primer was put on and dried all night Both are latex paint and primer Today when you painted the paint was not sticking to the primer?

If your paint isn't sticking to the primer, it could be due to a few reasons. First, ensure that the primer was compatible with the paint; even if both are latex, their formulations may not work well together. Additionally, if the primer was not cured properly or if there were contaminants on the surface, it could hinder adhesion. Lastly, high humidity or low temperatures during application can also affect the paint's ability to adhere to the primer.


How do you remove PVC plumbing primer?

you cant remove primer. if its an eye sore for you . You can try to hide the purple primer by either panting the pipe or you could use clear primer next time. primer was made to clean the fittings and weaken the pipe so the glue would react to the PVC pipe. making one piece. thay make purple prime so city inspectors could visualy see that the plumber properly prepared the pipe.


Can you apply primer over paint?

No, you should not apply primer over paint. Primer is meant to be applied before painting to help the paint adhere better to the surface. Applying primer over paint may not provide the desired results and could affect the overall finish of the paint job.


Under the Chinese civil service system who could become government officials?

In the Chinese Civil Service system, technically anyone could become a government official though often it goes to politically connected individuals.


Do I need to use primer before I paint in my bedroom?

Yes or it could peal later.


Could DNA be amplified with only one primer?

No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.


Is yak a domestic or a wild animal?

Generally wild. They could be domestic, when reared as cattle for milk.


Can you put primer over paint for better adhesion and coverage?

No, it is not recommended to put primer over paint for better adhesion and coverage. Primer is typically applied before painting to create a smooth surface for the paint to adhere to. Applying primer over paint may not provide the desired results and could affect the overall finish of the paint job.


What is connected load in electrcity?

Connected load refers to the total electrical capacity of all devices and appliances that are connected to a power supply system. It is typically measured in kilowatts (kW) and represents the maximum potential load that could be drawn if all connected devices were to operate simultaneously. This concept is important for utility companies when planning for electrical distribution and ensuring that the supply meets demand. Understanding connected load helps in efficient energy management and reduces the risk of overloading the electrical system.


Does nail glue work as primer?

No, nail glue is not a suitable substitute for nail primer. Nail glue is used to attach artificial nails, while nail primer is used to dehydrate the nail bed to promote better adhesion of the nail product and prevent lifting. Using nail glue as a primer may not provide the same benefits and could compromise the longevity of your manicure.


Could you define internet facing?

Internet facing means a system with a port, typically ehternet, directly connected to an internet modem or network interface unit.


What you can do about the Domestic Violence?

The things you could do about domestic violence is first. Avoid it, if your partner is violent discuss it, if no change, leave.