Tags Math and Arithmetic

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Math>Math & Arithmetic

What is 18 shared by 5?

Updated: 10/24/2023

Wiki User

∙ 13y ago

Best Answer

3.6

Wiki User

∙ 13y ago

This answer is:

More answers

AnswerBot

∙ 1y ago

18 divided by 5 is equal to 3 remainder 3.

This answer is:

Add your answer:

Earn +20 pts

Q: What is 18 shared by 5?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Math & Arithmetic

What is 18 shared into 2?

6478487748329

What is 30 shared by 5?

It is 6

What is the gcf shared between 20 and 5?

5.

What is 18 percent of 5?

5% of 18= 5% * 18= 0.05 * 18= 0.9

What is 18 over 5?

18/5 = 18÷5 = 3 3/5 OR 3.6

Related questions

What is 18 shared into 2?

6478487748329

What is 30 shared by 5?

It is 6

What name was shared by 18 french king?

le Roi-Soleil

What is the gcf shared between 20 and 5?

5.

What is 18 percent of 5?

5% of 18= 5% * 18= 0.05 * 18= 0.9

What is 60000 equally shared between 5 people?

Each person will receive 12000 if 60000 is equally shared between 5 people.

What are the greatest common factors shared by 20 and 5?

The GCF is 5.

What is 18 over 5?

18/5 = 18÷5 = 3 3/5 OR 3.6

What is are the different way to represent 18 times 5?

18 times 5 = 90 The product of 18 and 5 is 90 18 x 5 = 90 18*5 = 90

Greatest common factor shared by 45 and 40?

The GCF is 5.

What is the greatest common factor shared by 65 and 30?

What is the greatest common factor shared by 65 and 30 5

What is the factor shared by 45 and 40?

1 and 5

Trending Questions

How do you write 91.10 in word form? What is .39 of an inch? What is a number in front of the variable? How long would it take to go 80 miles if your are traveling 80 miles per hour? 50.16 divided by 0.76? How do you determine the number of people infected by a virus if the rate at which the virus spreads is proportional to both number of infected and uninfected people? What determines whether a pendulum swings in a plane or describes a three-dimensional path? What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'? What goes. Into. 26? How old are you if you were born in April 25.1977? What is Subtract 2 from the quotient of 630 and 90? What does a graph need to make it a graph? What comes next in the following sequence 4 2 6 3 10? 80 percent of women know this and only 20 percent of men do? What is 800 thousand divided by 360? A noble named blank put into effect the world's first generally blank constitution in 507 BC? What does x stand for in an equation? What is an arrangement in math? What is the least decimal can be rounded to 0.75? Why do you think God would allow a few copyist errors to creep into the Holy Bible?

Previously Viewed

What is 18 shared by 5?

Unanswered Questions

What ingredients are typically used in Mixture Namkeen? Is Mixture Namkeen spicy, and are there different flavor options? What are the popular ways to enjoy Mixture Namkeen? What are the most common mistakes people make when hiring cleaners for their homes or offices? What health issues are common in Himalayan kittens in Bangalore? Do you use OEM (Original Equipment Manufacturer) glass for replacements? Do removalists offer storage solutions? Is the tour conducted daily?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.