Tags Math and Arithmetic

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Math>Math & Arithmetic

What is 65 out of 100 in simplest form?

Updated: 9/17/2023

Wiki User

∙ 11y ago

Best Answer

13 out of 100

Wiki User

∙ 11y ago

This answer is:

Add your answer:

Earn +20 pts

Q: What is 65 out of 100 in simplest form?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Math & Arithmetic

What is the simplest form of 65 100?

13/2065/100 in simplest form is 13/20

How do you make 0.65 as a fraction in the simplest form?

It is 65/100 which is 13/20 in its simplest form

What is 65 percent as a fraction in simplest form and as a decimal?

65/100 = 13/20 = 0.65

What is the simplest form of 0.65?

0.65 = 65/100 = 13/20

How do you write 0.65 in fraction form then in simplest form?

It is 65/100 which can be simplified to 13/20.

Related questions

What is the simplest form of 65 100?

13/2065/100 in simplest form is 13/20

What is 65 over 100 in simplest form?

65 over 100 in simplest form is 13 over 20 65 divided by 5 = 13 100 divided by 5 =20

How do you make 0.65 as a fraction in the simplest form?

It is 65/100 which is 13/20 in its simplest form

What is the simplest fraction to 65 over 100?

To simplify 65 over 100, divide the 65 and then the 100 by 5. This gives the answer of 13 over 20.

How do you write 65 over 100 in simplest form?

65/100 = 13/20

What is 0.31 as a fraction in the simplest form?

31/100

What fraction has the same value as .65?

It is as a fraction: 65/100 or 13/20 in its simplest form

What is 65 percent as a fraction in simplest form and as a decimal?

65/100 = 13/20 = 0.65

Convert 65 percent to a fraction in simplest form.?

65% is 65/100 = 13/20

What is the simplest form of 0.65?

0.65 = 65/100 = 13/20

How do you write 0.65 in fraction form then in simplest form?

It is 65/100 which can be simplified to 13/20.

What is a fraction for 65 in simplest form?

The improper fraction for 65 in simplest form is 65/1.

Trending Questions

How do you write 91.10 in word form? What is .39 of an inch? What is a number in front of the variable? How long would it take to go 80 miles if your are traveling 80 miles per hour? 50.16 divided by 0.76? How do you determine the number of people infected by a virus if the rate at which the virus spreads is proportional to both number of infected and uninfected people? What determines whether a pendulum swings in a plane or describes a three-dimensional path? What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'? What goes. Into. 26? How old are you if you were born in April 25.1977? What is Subtract 2 from the quotient of 630 and 90? What does a graph need to make it a graph? What comes next in the following sequence 4 2 6 3 10? 80 percent of women know this and only 20 percent of men do? What is 800 thousand divided by 360? A noble named blank put into effect the world's first generally blank constitution in 507 BC? What does x stand for in an equation? What is an arrangement in math? What is the least decimal can be rounded to 0.75? Why do you think God would allow a few copyist errors to creep into the Holy Bible?

Previously Viewed

What is 65 out of 100 in simplest form?

Unanswered Questions

What is the number halfway between 20 and 60? How many times does 16 go into 146? What is 259 divided by 12 with a remainder? How many 3s go into 54? How many times does 63 go into 8? How many sevens in 63? How many times does 8 go into 11? Which came first pi or pie?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.