0
What else can I help you with?
Continue Learning about Natural Sciences
11 lb 8 oz equals how many oz?
11 lb 8 oz is equal to 184 oz.
How many cups equals 32 oZ's?
One cup = 8 oz. Therefore, 4 cups equals 32 oz. 4 x 8 = 32
64 fl oz equals how many cups?
8 fl oz = 1 cup . . 64 fl oz = 8 cups
How many ml equals 8 ounces?
8 US fl oz. is about 237mL
How many 8 oz cups are in 20 oz glass?
There are 2.5 8 oz. cups in a 20 oz. glass. 20 divided by 8 equals 2.5.
Related Questions
128 oz equals how many lb?
128 oz equals 8 pounds.
8 oz of mini marshmallows equals how many cups?
8 oz of miniature marshmallows equals 5 cups.
How many tomatoes equal 8 oz can?
4 tomatoes equals 8 oz
8 pounds equals how many oz?
8 oz is half a pound exactly.
11 lb 8 oz equals how many oz?
11 lb 8 oz is equal to 184 oz.
Half pound equals how many oz?
8.
8 oz equals to how many lb?
0.5
8 tbsp equals how many fl oz?
8 tbsp is approximately 3.6 fl oz.
8 pints equals how many fl oz?
128
8 oz equals how many gr?
226.8 g
How many cups of sugar equals 8 oz?
35
8 oz water equals how many cc?
8 fl oz is 236.6cc
Trending Questions
How far away is earth from pistol star?
Is there any part of universe still creating mass?
What do these things have in common Paleomagnetism seafloor spreading Pangaea Benioff zones transform faults fracture zones seamount chains Pacific hotspots?
How does reflectivity help meteorologists figure out the weather shown on weather maps?
Is an open circuit dangerous?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
If it is 9AM EST what time is it in Moscow?
What should be on the label of autoclave packages?
What kind of landscape is usually found where many types of bedrock have been folded and faulted?
Is calm a personality trait?
How can you use known densities of pure substances and a measured density of a mixture to calculate the percent of each component?
How long does it take for 32 oz of water to boil in a pot?
What are the characteristic motions of sarcina lutea?
What is an amorphous when heated?
Which physical science deal with stars and planets?
Can amine ionize?
If an atom has six protons and four neutrons what is its?
Why is the Amazon being protected?
What happens when you burn chocolate?
When living and non living things interact what is it called?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.